ID: 973233249

View in Genome Browser
Species Human (GRCh38)
Location 4:47866688-47866710
Sequence AGATTCCCAAGCACCAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973233249_973233253 13 Left 973233249 4:47866688-47866710 CCTTGGCTGGTGCTTGGGAATCT 0: 1
1: 0
2: 0
3: 27
4: 283
Right 973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG No data
973233249_973233252 -9 Left 973233249 4:47866688-47866710 CCTTGGCTGGTGCTTGGGAATCT 0: 1
1: 0
2: 0
3: 27
4: 283
Right 973233252 4:47866702-47866724 TGGGAATCTGGATTTCAGGAAGG 0: 2
1: 2
2: 19
3: 69
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973233249 Original CRISPR AGATTCCCAAGCACCAGCCA AGG (reversed) Intronic
902253533 1:15171951-15171973 AGATTTCCAGGCCCCAGCCCAGG + Intronic
902332539 1:15737630-15737652 TGATCCTCCAGCACCAGCCAAGG - Intronic
904366262 1:30012752-30012774 GGAGTGCCAAGCACCTGCCAGGG + Intergenic
906670698 1:47652327-47652349 AGCTTCCCAAGGCACAGCCAGGG + Intergenic
907428188 1:54394631-54394653 AGCTTCCCATGGACCTGCCATGG + Intronic
909356787 1:74718718-74718740 AGACTCTCAGGCACCAGCTATGG + Intronic
909406982 1:75302399-75302421 ATAATCAGAAGCACCAGCCAGGG + Intronic
911972133 1:104452264-104452286 AGATGCTCCAGCTCCAGCCATGG + Intergenic
915725548 1:158014525-158014547 GGATTTCAAAGCAGCAGCCAGGG + Intronic
916498772 1:165368744-165368766 CCATTCCAAAGCACCAGTCACGG - Intergenic
916842493 1:168614417-168614439 AGATTCCCAGGCTGCAGGCAAGG + Intergenic
920770197 1:208877013-208877035 AGATACCCAAGAATCAGGCATGG - Intergenic
920783970 1:209022724-209022746 CAATTCCCAAGCGCCAGCCCTGG + Intergenic
921623391 1:217351344-217351366 AGATTACCAAGCCCCACCTAAGG + Intergenic
921625484 1:217373820-217373842 ACATTCCCCCGCACCAGCCATGG + Intergenic
923728950 1:236532221-236532243 AAGTTCCCAGACACCAGCCAGGG + Intronic
1065971732 10:30810976-30810998 AGCTTCTCATGTACCAGCCATGG + Intergenic
1066697067 10:38088359-38088381 ACATTCCCAGATACCAGCCAAGG + Intergenic
1067177821 10:43962535-43962557 ACAAACCCAAGCACCAGCCCTGG - Intergenic
1067514571 10:46927039-46927061 AAGTTCCCAGACACCAGCCAAGG + Intronic
1067647689 10:48124774-48124796 AAGTTCCCAGACACCAGCCAAGG - Intergenic
1068087226 10:52389381-52389403 ACATTCACAAGCCCCATCCATGG - Intergenic
1069370920 10:67746934-67746956 AGTTTCCCCAGCACCAGCAGGGG - Intergenic
1070904172 10:80057086-80057108 AGATTCCCCAACTCCAGCCGGGG + Intergenic
1074881188 10:117660623-117660645 AGCTTCAAAAGCATCAGCCAAGG - Intergenic
1075095257 10:119466948-119466970 AGCTTCCCAAGGCACAGCCAGGG + Intergenic
1077845712 11:6022274-6022296 AGATTCAGAAGCACCAGTGAAGG + Intergenic
1078747481 11:14128934-14128956 AGCTGCTCAAGCTCCAGCCATGG - Intronic
1078948140 11:16094959-16094981 AGATTCACAAGCAGCAGAAAAGG + Intronic
1079554328 11:21740431-21740453 AGATGCTCTAGCTCCAGCCATGG - Intergenic
1080858801 11:36135338-36135360 ATCTTCCCAAACCCCAGCCATGG - Intronic
1080971637 11:37284536-37284558 AGATTCCTGAGCACTAGCCATGG - Intergenic
1081064484 11:38523744-38523766 ACATTCCCTAACACCAGCCCAGG + Intergenic
1081294425 11:41368135-41368157 AGATATCCAAGCACCAATCATGG + Intronic
1081628559 11:44671490-44671512 AGCTGCTCCAGCACCAGCCAGGG + Intergenic
1082068231 11:47917970-47917992 AGATTGCAAAGCACCACTCAAGG - Intergenic
1084146897 11:67269784-67269806 ACATCCCCAGGCACCAGCCATGG - Intronic
1084673547 11:70621526-70621548 TATTTCCCAAGCACCTGCCATGG - Intronic
1084673941 11:70623510-70623532 TATTTCCCAAGCACCTGCCATGG - Intronic
1087655629 11:100919374-100919396 ACATTCCCAGACACCAGCCAAGG + Intronic
1089159098 11:116424070-116424092 ATATTCCCAGGCCCCAGCTAGGG - Intergenic
1089633904 11:119800264-119800286 AGATACCCAAGCACCTGCAGAGG - Intergenic
1091619529 12:2075820-2075842 AGACTCCCAAGAACAAGCCCTGG - Intronic
1091691715 12:2601736-2601758 CAAGTCCCAAGCACCATCCATGG - Intronic
1094052768 12:26239022-26239044 AGGTTTCCAAGCCACAGCCAGGG - Intronic
1094294015 12:28883161-28883183 AGATTCCCAATCAGCTGCCTTGG + Intergenic
1094399847 12:30050737-30050759 AGATTCCCAGGCCCAAGCCCAGG + Intergenic
1095554375 12:43483179-43483201 ACATTCCCCAGCACCAACCTGGG + Intronic
1096994895 12:55832296-55832318 TGATTCCAAAGCAGCAGCAAAGG - Intergenic
1097130763 12:56809381-56809403 ATATTCCCTGGCGCCAGCCATGG - Intergenic
1097687798 12:62707376-62707398 ACATTCCCAAGCAATAGCAAGGG + Intronic
1101071133 12:101076982-101077004 AAGTTCCCAGACACCAGCCAAGG - Intronic
1101851702 12:108408534-108408556 AGATTCTCAGGCCCCAGCCCAGG - Intergenic
1102576329 12:113858374-113858396 AGACACCCAAGAAGCAGCCACGG - Intronic
1103024745 12:117564248-117564270 GGATTCCCAGGCACCAGGGAAGG + Intronic
1104629012 12:130383683-130383705 AGGTTTCTAAGAACCAGCCAGGG - Intergenic
1104760211 12:131293629-131293651 AGATTCCAAGACACCAGCCAAGG - Intergenic
1104805643 12:131587636-131587658 ACATTCCCCAGTGCCAGCCAGGG + Intergenic
1104819559 12:131667017-131667039 AGATTCCAAGACACCAGCCAAGG + Intergenic
1108699745 13:52933584-52933606 GGATTTCCAACCACCTGCCAAGG + Intergenic
1109260713 13:60142628-60142650 AGACAGCCCAGCACCAGCCATGG + Intronic
1109652204 13:65343285-65343307 AGCTTCCCAAACACCAGCAAAGG + Intergenic
1111305597 13:86409491-86409513 GGATTCCCTACCCCCAGCCAAGG + Intergenic
1111629129 13:90826864-90826886 AGTTTCTCCAGCTCCAGCCATGG - Intergenic
1113338777 13:109402097-109402119 AGATGCAGAAGCCCCAGCCAGGG + Intergenic
1114631436 14:24161763-24161785 AGATTCCCGAGCATCAGCAGAGG - Intronic
1116030763 14:39568321-39568343 ACATTCAAAACCACCAGCCAAGG - Intergenic
1116872915 14:50084788-50084810 AGACTCCCTAGCACCAGCGAAGG - Intronic
1117627159 14:57651681-57651703 ATTTTCCCAAGCCGCAGCCATGG - Intronic
1117985157 14:61379757-61379779 ATATTCCCCATCTCCAGCCAGGG + Intronic
1120951695 14:90047594-90047616 ATGTTCCCAAGGTCCAGCCAAGG + Intergenic
1122441297 14:101734036-101734058 AGATTCACATGCAGCAGCCTTGG + Intergenic
1123194279 14:106601504-106601526 AGATTCCCAGGCTCCAGGGAAGG - Intergenic
1202829272 14_GL000009v2_random:8736-8758 AATTTCCTAAACACCAGCCAAGG + Intergenic
1127090067 15:55457882-55457904 ACATTCCCCAGCACCAGCCTGGG + Intronic
1127282873 15:57506602-57506624 AAATTCCCCAGAGCCAGCCAGGG - Intronic
1127525811 15:59791371-59791393 ACATTCCCCAGTGCCAGCCAGGG - Intergenic
1128063542 15:64750118-64750140 AGATTCCTAAGAAACAGACAGGG + Intronic
1128064394 15:64755399-64755421 TGATTCCCAAACACCCGCCTTGG + Intronic
1128901199 15:71424030-71424052 CTATTCCCCAGCAGCAGCCATGG - Intronic
1129110505 15:73334426-73334448 AGAGCCCCCAGCACCAGCCGGGG + Intronic
1130738062 15:86571101-86571123 ATATTCCCCAGTGCCAGCCAGGG - Intronic
1130789388 15:87136232-87136254 AGGTTCTCAGACACCAGCCAAGG - Intergenic
1133165760 16:3946194-3946216 ACATCCACCAGCACCAGCCAGGG + Intergenic
1133401674 16:5492108-5492130 AGATTCCCAGGCCTCAGCCCTGG - Intergenic
1136866035 16:33755272-33755294 AAATTTCCAAACACCAGCGAAGG - Intergenic
1137584327 16:49655162-49655184 TGATACCCAAGCTTCAGCCATGG - Intronic
1137863496 16:51870170-51870192 AGATCCCCAATCAGCAGCCATGG + Intergenic
1138922772 16:61553225-61553247 AGATTTCCAATCACCAATCAAGG + Intergenic
1139618196 16:68113911-68113933 AGTTTCCCCAACACCAGCAAAGG + Intronic
1140813674 16:78601407-78601429 GAATTCCCATGCACCAGTCAAGG - Intronic
1141100909 16:81196901-81196923 AGACTGGCAGGCACCAGCCAGGG - Intergenic
1141545129 16:84761798-84761820 AAATTCCCAGACACCAGCCAAGG + Intronic
1142204085 16:88774519-88774541 AGAGTCCCCAGCAGCAGCCTGGG + Intronic
1203106119 16_KI270728v1_random:1360831-1360853 AAATTTCCAAACACCAGCGAAGG + Intergenic
1203127395 16_KI270728v1_random:1601537-1601559 AAATTTCCAAACACCAGCGAAGG - Intergenic
1143340332 17:6206140-6206162 ACGTTCCCAGACACCAGCCAAGG - Intergenic
1143756205 17:9069625-9069647 AGAGTCCCAAGAAGCAGGCAGGG - Intronic
1143886543 17:10069153-10069175 AAGTTCCCAGACACCAGCCAAGG + Intronic
1144609799 17:16700514-16700536 AAGGTCCCAAACACCAGCCAAGG + Intronic
1144902943 17:18614903-18614925 AAGGTCCCAAACACCAGCCAAGG - Intergenic
1145129623 17:20331848-20331870 AAGGTCCCAAACACCAGCCAAGG + Intergenic
1145195102 17:20886094-20886116 AAGGTCCCAAACACCAGCCAAGG - Intronic
1146274821 17:31509911-31509933 AGTTGCCCAGGCACCAGCCAAGG - Intronic
1146423078 17:32707631-32707653 AAGTTCCCAGACACCAGCCAAGG - Intronic
1146655604 17:34632924-34632946 AGTTTCCCAAGTATCCGCCATGG - Intronic
1147149177 17:38504103-38504125 AGATACCAGAGCACCAACCAAGG - Intronic
1147214870 17:38893303-38893325 AGATTCCTAGGCCCCACCCAAGG + Intronic
1147266622 17:39238259-39238281 AGGTCCCCAAGCTGCAGCCAGGG - Intergenic
1147648362 17:42047941-42047963 AGAGTCCCAAGGGCCAGGCACGG - Intronic
1147763767 17:42818955-42818977 AGACTCTCAAGCACCAGCTGAGG + Intronic
1148875578 17:50684925-50684947 AGGTTTCCCAGCACCCGCCAGGG - Intronic
1152227476 17:79099065-79099087 AGATTCCAAAGTCCCAGCAATGG - Intronic
1152318788 17:79596407-79596429 AGTGTGCCCAGCACCAGCCAGGG + Intergenic
1152615128 17:81334414-81334436 AGATTCCCAAGCCCCAGGATTGG + Intergenic
1153078144 18:1189697-1189719 AGATTAACAGGCACCAGCCAAGG - Intergenic
1153530454 18:6041046-6041068 AGATTCCCAATCAGGAGTCAGGG + Intronic
1154505172 18:15031078-15031100 GGATCCCTAAGTACCAGCCAAGG - Intergenic
1155990134 18:32271560-32271582 AGATTCCCAGGCCCCACCCTGGG - Intronic
1156020981 18:32598642-32598664 ACTTTCCCCAGCACCAGCCTGGG + Intergenic
1158239604 18:55361721-55361743 TGAGTCCCAAGCACCAGCCCAGG + Intronic
1159346800 18:67216314-67216336 GAATTCCCAAGCACAACCCAGGG - Intergenic
1160492149 18:79347568-79347590 AGAGCCCCCAGCACCAGCCCAGG - Intronic
1160579830 18:79877399-79877421 AGATACACAGGCAGCAGCCAAGG + Intronic
1163228114 19:15979301-15979323 AAATTCTGAAGCGCCAGCCAGGG + Intergenic
1164252316 19:23489664-23489686 AGATTCTGAAGCATAAGCCAAGG + Intergenic
1165739574 19:38197345-38197367 AGAGTCCCAGGCACCAGGCTCGG - Intronic
1165886461 19:39082535-39082557 GAATTCCCAACCACCAGCCCAGG - Intergenic
1166897581 19:46033515-46033537 ACATTCCCCAGCTCCAGCCAGGG + Intergenic
1167050397 19:47074540-47074562 AGCTTCCCAGACACCAGCCGAGG - Intronic
1168239995 19:55084081-55084103 AGGATCCCAAGCACCAGACTTGG - Intronic
1168610541 19:57795922-57795944 AGAGTCCTGAGTACCAGCCAAGG - Intronic
1202643421 1_KI270706v1_random:119053-119075 AATTTCCTAAACACCAGCCAAGG - Intergenic
927017173 2:18976732-18976754 ATGTTCCCAACCACAAGCCAGGG + Intergenic
927551365 2:24002944-24002966 AGATTCCCAAGACCCATTCAGGG - Exonic
927927580 2:27024503-27024525 AGAGCCACCAGCACCAGCCATGG + Intronic
929874212 2:45783105-45783127 AGTCTGCCAAGCACCAGCCTGGG - Intronic
930612124 2:53554922-53554944 ACATTCCCCAGTGCCAGCCAGGG + Intronic
933534823 2:83558280-83558302 AGACTCCACACCACCAGCCAAGG - Intergenic
934499316 2:94842557-94842579 AATTTCCTAAACACCAGCCAAGG - Intergenic
934634548 2:95972144-95972166 AAATTTCCAAACACCAGCAAAGG - Intronic
934799086 2:97133092-97133114 AAATTTCCAAACACCAGCGAAGG + Intronic
935578283 2:104733713-104733735 AGAGTCCCAGGCACCAGACCAGG + Intergenic
935710020 2:105889874-105889896 ATATTCTCAAGGGCCAGCCATGG - Intronic
935952668 2:108345206-108345228 AGTCTCCCAGGCACCAGCAAGGG + Intergenic
937282892 2:120732544-120732566 AGCTTAACAAGAACCAGCCAGGG - Intergenic
938462940 2:131509741-131509763 AGGCCCCCAGGCACCAGCCAGGG - Intergenic
938703378 2:133898772-133898794 AGGTTCCCAGGCACCAAGCATGG + Intergenic
940537999 2:154971190-154971212 AGATTTACAAACACCAACCAGGG + Intergenic
943430640 2:187796696-187796718 AGTTTCCCCAGCACCATCTATGG - Intergenic
944602878 2:201321220-201321242 ATATTCCCTAGCACCAGCCTGGG + Intronic
944615434 2:201454167-201454189 AGATACAAAAGCACCATCCACGG - Intronic
944639882 2:201714166-201714188 TAATTCCCAAGTGCCAGCCAAGG - Intronic
945029585 2:205650834-205650856 AGTCCCCCAAGCACCAGCCCAGG + Intergenic
945599147 2:211836662-211836684 AACTTCCCAAACACCAGACAAGG + Intronic
947823861 2:233091126-233091148 GGAGTCCCAAGCACAAGGCAGGG - Intronic
948713287 2:239839341-239839363 AGATTCCCTGGTATCAGCCATGG + Intergenic
1169814023 20:9638072-9638094 AGATTCCCAAGCCCCACCCTAGG - Intronic
1169907362 20:10617318-10617340 AGATTCCCAAGACCCATCCCTGG - Intronic
1170458474 20:16554800-16554822 ACATTCCCCAGTGCCAGCCACGG + Intronic
1170683346 20:18546694-18546716 AGAGTCCCAGGCACCTGCTATGG - Intronic
1171040035 20:21754466-21754488 GGATTCCAAAGCAGCAGCCTAGG - Intergenic
1171144044 20:22766403-22766425 AGATGGCAAAGCACCAGCGAGGG + Intergenic
1171890540 20:30709259-30709281 AATTTCCTAAACACCAGCCAAGG - Intergenic
1174068003 20:47879451-47879473 GGATTCCCCAGCAGCTGCCAAGG - Intergenic
1175793580 20:61757528-61757550 AGACTCCCCAGGACCAGGCAGGG + Intronic
1176608456 21:8853576-8853598 AATTTCCTAAACACCAGCCAAGG + Intergenic
1177049938 21:16220479-16220501 AGATTCCCAAGCATCTGTCTTGG + Intergenic
1177767322 21:25473648-25473670 AGCTGCTCAAGCTCCAGCCATGG + Intergenic
1179398735 21:41064561-41064583 AGATTCCGAATCAGCTGCCAAGG + Intergenic
1180902611 22:19385629-19385651 AGATGCTCAAGTACCAGCGAAGG - Exonic
1180919542 22:19514199-19514221 AGATACCCATGGCCCAGCCAAGG - Intronic
1181408441 22:22701640-22701662 AGATTCTCCAGCTCCAGCCTGGG + Intergenic
1181448665 22:23000881-23000903 AGATGCTCCAGCTCCAGCCATGG - Intergenic
1181867911 22:25873839-25873861 AGATTCCCAGGCCCCAGGAAAGG - Intronic
1183047800 22:35234134-35234156 AAGTTCCCAGACACCAGCCAAGG + Intergenic
1183330603 22:37218804-37218826 AGATCCCCCAGCACCACCCCAGG - Intergenic
1184047258 22:41979184-41979206 AGATCCCCAAGCAGCATCTAGGG - Intronic
1184277597 22:43419040-43419062 AGATTCAAAAGCCCCTGCCAGGG - Intronic
1184324636 22:43774103-43774125 ATATTCACAAGCAGCAGCTAGGG + Intronic
949285563 3:2399230-2399252 AGATTCCTTATCACCAGCCATGG + Intronic
950123008 3:10494273-10494295 AGATTCCCTTGCATCAGGCATGG + Intronic
950168288 3:10817592-10817614 AAATTCCCAAACCCCAGCGAAGG + Intronic
950699613 3:14731759-14731781 AAGTTCCCAGACACCAGCCAAGG + Intronic
950849323 3:16047815-16047837 AGATTCTCAAGCCCCACCCCAGG + Intergenic
951721813 3:25707638-25707660 ACATTCCCTAGCCTCAGCCAAGG + Intergenic
952229421 3:31414435-31414457 AGTTTCCAAAGCACTAGGCAGGG + Intergenic
952552899 3:34499033-34499055 AGATTCAGAAGGAGCAGCCAAGG + Intergenic
953461315 3:43083400-43083422 ATATTCCCAGGCACCAGTCCTGG + Intronic
954529265 3:51304237-51304259 AGTTTCCCCAGCACCAGCAGGGG + Intronic
954631874 3:52052172-52052194 AGATTCACAAGAGGCAGCCATGG + Intronic
954745663 3:52786224-52786246 AGAGCCCCTAGCACCAGCCAGGG + Intronic
955157125 3:56427703-56427725 AGATGATCAAGCACTAGCCAAGG + Intronic
955322817 3:57986404-57986426 AGAGTCCAAAGCAACAGCCCAGG + Intergenic
955538635 3:59951324-59951346 AGATTCCCAGTCAACAGCAATGG - Intronic
956590743 3:70911990-70912012 TGATTCCCAAGCCCTAACCAGGG - Intergenic
956704997 3:71991980-71992002 AGATTCCCAGGCACCACCCCCGG - Intergenic
956920008 3:73918331-73918353 TGATGCCCAAGCAACAGCTAAGG + Intergenic
958474902 3:94568695-94568717 AGATGCTCCAGCTCCAGCCATGG + Intergenic
961005723 3:123404139-123404161 CGATTACAAAGCACCAGCGAAGG + Intronic
961647597 3:128400777-128400799 TGTTTCCCAAGCCCTAGCCATGG - Intronic
962082530 3:132155779-132155801 AGATTCCCAAACCCCACCCAAGG - Intronic
963531371 3:146476674-146476696 AGTCTCCCAGGCACCAGCCGGGG - Intronic
964901028 3:161658824-161658846 AGGCTCCCAGACACCAGCCAAGG + Intergenic
966659217 3:182395770-182395792 TGTTTTCCAAACACCAGCCATGG + Intergenic
968736630 4:2300615-2300637 GGCTTCCCAGCCACCAGCCAGGG - Intronic
971240330 4:24882684-24882706 AGAGTCTCAGGCAGCAGCCAGGG - Intronic
972106558 4:35495077-35495099 ACATTCCCCAGTGCCAGCCATGG + Intergenic
972631439 4:40845466-40845488 ATTTTCCCAAGGAACAGCCACGG - Intronic
973233249 4:47866688-47866710 AGATTCCCAAGCACCAGCCAAGG - Intronic
974120395 4:57631257-57631279 AGAGTGCCAAGGACCAGCCATGG - Intergenic
974911885 4:68132770-68132792 AGATTCCCACCCACCAGCATAGG + Intergenic
975029925 4:69601793-69601815 ACATTCCCTAGCACCAGTCTGGG + Intronic
976988086 4:91327400-91327422 AGACTCTCCAGCTCCAGCCATGG - Intronic
980498833 4:133621888-133621910 ACATTCCCAGGCAGCAGCAAAGG + Intergenic
983237356 4:165194614-165194636 GAATTCCCAAGCACAAGCTAAGG + Intronic
984674563 4:182531930-182531952 GGGTTCCCAGACACCAGCCACGG + Intronic
1202770793 4_GL000008v2_random:204967-204989 AATTTCCTAAACACCAGCCAAGG - Intergenic
985542562 5:493698-493720 AGATTCCAAAACACCAGCCCCGG + Intronic
985627306 5:995730-995752 AGGTTGCCAGGGACCAGCCATGG - Intergenic
986487091 5:8248671-8248693 GGATGCCTAAGCTCCAGCCATGG - Intergenic
986785589 5:11111388-11111410 CGATCCCCAATCCCCAGCCAGGG - Intronic
987829124 5:23073582-23073604 AGCTTCCCAGATACCAGCCAAGG - Intergenic
987999680 5:25331747-25331769 ACATTCCCCAGTGCCAGCCATGG + Intergenic
990385227 5:55253836-55253858 AAGTTCCCAGGCTCCAGCCAAGG - Intergenic
990563958 5:57010416-57010438 AAGTTCCCAAACTCCAGCCAAGG + Intergenic
991591310 5:68254443-68254465 AGATTCCAATGTCCCAGCCATGG - Intronic
992391887 5:76337222-76337244 AGATGGCCATGCACAAGCCAAGG - Intronic
992441584 5:76801972-76801994 AGATTGACAAGGAGCAGCCAAGG + Intergenic
993171946 5:84430704-84430726 ACATTCCCCAACACCAGCCTGGG - Intergenic
993615945 5:90112589-90112611 AGATACTCATTCACCAGCCATGG + Intergenic
995591617 5:113705798-113705820 AGACACCCCAGCCCCAGCCATGG - Intergenic
996004646 5:118405627-118405649 AGCTTCCCCAGCACCAGCAGGGG + Intergenic
997680807 5:135749444-135749466 AGATTCCCAGGCCCCATCCCTGG + Intergenic
997734006 5:136200259-136200281 AGCTGCCCAGGCAGCAGCCAAGG - Intergenic
1000011737 5:157239588-157239610 AAGTTCCCAAACACCAGCCAAGG + Intronic
1001385884 5:171338367-171338389 CCATTTCCAAGCAGCAGCCATGG + Intergenic
1001745669 5:174090555-174090577 AGCTTCCCAGACACCAGCCAAGG + Intronic
1003432553 6:6053231-6053253 AGAATTCCAAATACCAGCCAGGG - Intergenic
1004476606 6:15979272-15979294 TGATCCCCAAGCCCCGGCCATGG + Intergenic
1007438668 6:41838456-41838478 ATATTCCCCAGAACCAGCCCAGG + Intronic
1008130356 6:47714066-47714088 AGATTCCCAGGCAAGAGCTAAGG + Exonic
1009715590 6:67389677-67389699 AGACTCCAATTCACCAGCCAAGG + Intergenic
1011294106 6:85808352-85808374 AGCTTCTCCAGCTCCAGCCATGG - Intergenic
1011564310 6:88658433-88658455 ACACTCCCCAGCACTAGCCAGGG + Intronic
1014898102 6:126928615-126928637 AGATTCCCAGGCACCACCAGTGG - Intergenic
1015239969 6:131011290-131011312 AGATTCCCAAGTACCTGCAAAGG + Intronic
1015434820 6:133173312-133173334 ATATTCCCCAGTGCCAGCCATGG + Intergenic
1015574330 6:134655105-134655127 AGATTACCAAGAAACAGCAAAGG - Intergenic
1016783448 6:147985526-147985548 AGGTTCCCAAACCCCATCCAAGG - Intergenic
1021723653 7:23529890-23529912 AGATTCCCACCTACCAGCCTGGG - Intronic
1023404901 7:39822977-39822999 AAGGTCCCAAACACCAGCCAAGG + Intergenic
1024157485 7:46639720-46639742 AGAGTCCCAAGCCCCACCCCAGG - Intergenic
1024598775 7:50961786-50961808 AGATGCCCAAGCCCCAACCTAGG - Intergenic
1026679615 7:72455752-72455774 AGATTCCCAGGCTCCAAGCAAGG + Intergenic
1027376779 7:77558639-77558661 AAGTTCCCAGACACCAGCCAAGG - Intronic
1028570526 7:92281402-92281424 AAGTTCCCAGACACCAGCCATGG + Intronic
1029999782 7:105047358-105047380 AAATTCCCAAATGCCAGCCAAGG + Intronic
1030885705 7:114933997-114934019 ACATTCCCAAGAACAGGCCAAGG - Intronic
1032631799 7:133661180-133661202 AGACTGCCAAGCAGCGGCCATGG - Intronic
1032717584 7:134523511-134523533 AGGTTTCCAAGCACCCTCCAAGG - Intergenic
1033401177 7:141026717-141026739 ACATTGCCTAGCACCAGCCCAGG - Intergenic
1033800286 7:144892973-144892995 ATATTGCCAAGCATCTGCCAGGG - Intergenic
1034341333 7:150358245-150358267 TGCTTGCCAAGCAGCAGCCAAGG + Intergenic
1034444877 7:151108725-151108747 AGAGGCCCAAGCTCCAGCCTGGG + Intronic
1035175431 7:157046711-157046733 AGATCCCCAAACTCCAGGCAGGG + Intergenic
1038374624 8:27026686-27026708 ACATTTCTAAGCACCAGACATGG + Intergenic
1039482257 8:37883010-37883032 AGGTAGCCAGGCACCAGCCACGG + Intronic
1040867933 8:52069779-52069801 ACATTCCCCAGCACCAGCACAGG - Intergenic
1042190830 8:66185525-66185547 AGATGGCCAACCACAAGCCAAGG - Intergenic
1042226961 8:66521653-66521675 AGAGTCCCACTCGCCAGCCACGG + Intergenic
1042285151 8:67101348-67101370 ATATTCCCAGGTGCCAGCCAAGG + Intronic
1043693602 8:83188955-83188977 AAATTCCCAAGTGACAGCCAAGG - Intergenic
1044774858 8:95677590-95677612 ACATTCCCCAGTGCCAGCCATGG - Intergenic
1047534492 8:125706931-125706953 AGATTGACAAGCATCATCCAAGG + Intergenic
1049220600 8:141427097-141427119 AGATGCCCAACCACCTGACATGG - Intronic
1050400520 9:5248501-5248523 ACATTCCCCAGTACCAGCCCAGG + Intergenic
1051361645 9:16286288-16286310 AGGTTCGCAAGCACTAGCCTGGG - Intergenic
1053468903 9:38331406-38331428 AAGTTCCCAGACACCAGCCAAGG + Intergenic
1053507089 9:38652241-38652263 AGATTCACAGGCCCCACCCAGGG - Intergenic
1053657843 9:40237980-40238002 AATTTCCTAAACACCAGCCAAGG + Intronic
1054369966 9:64384252-64384274 AATTTCCTAAACACCAGCCAAGG + Intronic
1054526753 9:66138245-66138267 AATTTCCTAAACACCAGCCAAGG - Intronic
1054677595 9:67874006-67874028 AATTTCCTAAACACCAGCCAAGG + Intronic
1058272169 9:102986207-102986229 ATATTTCCCAGCACCAGCCTGGG + Intergenic
1059393990 9:114019006-114019028 AGAGTCTCAAGTCCCAGCCATGG - Intronic
1059787163 9:117598299-117598321 AGATTTCAAAGCAACTGCCAAGG - Intergenic
1061025669 9:128047742-128047764 AGATTCCCAGGCCCCACACATGG - Intergenic
1062332616 9:136051295-136051317 AGGTTCCCAAGCCGCCGCCAGGG + Intronic
1062589381 9:137266613-137266635 AGATACCCCAGAACCAGCCAGGG - Intronic
1062589391 9:137266643-137266665 AGACACCCCAGAACCAGCCACGG - Intronic
1062726277 9:138075810-138075832 ATATTCCCAAACACCTGCAATGG - Exonic
1203703857 Un_KI270742v1:18786-18808 AATTTCCTAAACACCAGCCAAGG + Intergenic
1203560163 Un_KI270744v1:47036-47058 AATTTCCTAAACACCAGCCAAGG - Intergenic
1186426766 X:9468565-9468587 AGATTCCCCATGACCAGGCAGGG - Intronic
1187276833 X:17823735-17823757 AGATTCCCAGGCCACACCCAAGG + Intronic
1187891052 X:23935386-23935408 AGATCCATAAGCACCAGCTACGG + Exonic
1188662904 X:32781609-32781631 ACATTCACAAGCAGCAGCAAGGG - Intronic
1189466503 X:41281610-41281632 AAGTTCCCAGACACCAGCCAAGG + Intergenic
1189556383 X:42149879-42149901 AGATTCCACAGCACAAGGCAAGG - Intergenic
1190025783 X:46921578-46921600 AATTTCCCAAACACCAGCTAAGG - Intronic
1190059998 X:47204662-47204684 AAGTTCCCAGACACCAGCCAAGG + Intronic
1190098146 X:47499300-47499322 AAGTTCCCAGACACCAGCCAAGG - Intergenic
1191711009 X:64149931-64149953 AGATGCTCCAGCTCCAGCCATGG - Intergenic
1192930567 X:75801547-75801569 ATATTCCCCAGCAACAGCCGAGG + Intergenic
1193666304 X:84322575-84322597 AGATGGCCAAGCACCCACCAGGG + Intronic
1194675535 X:96789439-96789461 AGGTTCCCAGATACCAGCCAAGG + Intronic
1198392700 X:136192428-136192450 AGATTACGAAGCATGAGCCATGG - Intronic
1198640816 X:138754600-138754622 AAGTTCCCAGACACCAGCCAAGG - Intronic
1199298536 X:146186436-146186458 ACATTTCCCAGCACCAGCCCAGG - Intergenic
1202585950 Y:26427320-26427342 AAATTTCCAAACACCAGCAAAGG + Intergenic