ID: 973233253

View in Genome Browser
Species Human (GRCh38)
Location 4:47866724-47866746
Sequence GTTCCCACCATTCCCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973233249_973233253 13 Left 973233249 4:47866688-47866710 CCTTGGCTGGTGCTTGGGAATCT 0: 1
1: 0
2: 0
3: 27
4: 283
Right 973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG No data
973233244_973233253 28 Left 973233244 4:47866673-47866695 CCTTGTAAGACTAGCCCTTGGCT 0: 1
1: 0
2: 2
3: 14
4: 152
Right 973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG No data
973233248_973233253 14 Left 973233248 4:47866687-47866709 CCCTTGGCTGGTGCTTGGGAATC 0: 1
1: 0
2: 2
3: 24
4: 237
Right 973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973233253 Original CRISPR GTTCCCACCATTCCCAGAAC TGG Intronic
No off target data available for this crispr