ID: 973240265

View in Genome Browser
Species Human (GRCh38)
Location 4:47949105-47949127
Sequence CCACCTGCATAGCCACTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973240265_973240268 22 Left 973240265 4:47949105-47949127 CCATACAGTGGCTATGCAGGTGG 0: 1
1: 0
2: 1
3: 5
4: 79
Right 973240268 4:47949150-47949172 TCCCCACTTGCCAAGAGTGTTGG 0: 1
1: 0
2: 0
3: 22
4: 146
973240265_973240267 -8 Left 973240265 4:47949105-47949127 CCATACAGTGGCTATGCAGGTGG 0: 1
1: 0
2: 1
3: 5
4: 79
Right 973240267 4:47949120-47949142 GCAGGTGGTGCACAAAATTCAGG 0: 1
1: 0
2: 0
3: 4
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973240265 Original CRISPR CCACCTGCATAGCCACTGTA TGG (reversed) Intronic
900099224 1:953989-954011 CCACCAGAATAGCACCTGTATGG + Exonic
902092794 1:13916755-13916777 CCACCTGGGGAGCCACTGAAAGG + Intergenic
903368522 1:22819470-22819492 CCATCTGCATAGCCCCAGTAGGG + Intronic
910666317 1:89728929-89728951 CCCTCTGAAGAGCCACTGTAGGG - Intronic
912577448 1:110686355-110686377 CCACCTGCAAAGCCACCAAAAGG - Intergenic
915514310 1:156403896-156403918 CCTCCTGCACAGGCACTCTAGGG + Intergenic
915591725 1:156874748-156874770 CCACCCGCACAGCCACTGCAGGG + Intronic
918075334 1:181166676-181166698 CCACATGCAGAGCCACTACAGGG - Intergenic
921349403 1:214220284-214220306 CCACCTGCATCCTCACAGTATGG - Intergenic
924885987 1:248217267-248217289 CCATCTACAGAGTCACTGTAAGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063011215 10:2023465-2023487 GCAGCTGCCAAGCCACTGTAAGG - Intergenic
1065034618 10:21625005-21625027 CCACCATCATAGCCATAGTAGGG + Intronic
1070961108 10:80500815-80500837 CCACATGCAGGGCCGCTGTAGGG - Intronic
1073636152 10:105200836-105200858 CCACCTCCATAGAGAATGTAAGG - Intronic
1074848199 10:117417393-117417415 CCATCTGTTTAGCCACTGCAGGG - Intergenic
1077895294 11:6449119-6449141 ACATCTGCAGAACCACTGTATGG - Exonic
1080547147 11:33331709-33331731 CCCACTGCACTGCCACTGTAAGG - Intronic
1080862966 11:36166169-36166191 CCCCCTGCATTCCCACTCTATGG - Intronic
1090626513 11:128613505-128613527 CCAGCTGCCTAGCCACAGCACGG - Intergenic
1096096757 12:48940550-48940572 CCATCTACATAGCAAATGTAGGG + Intronic
1097249260 12:57623556-57623578 CCACCTTAAAAGCCACTGTTGGG - Intronic
1099110742 12:78557359-78557381 CCCCCTTCATAGACACTGTCAGG - Intergenic
1100863362 12:98830560-98830582 CAAACAGCATAGCCACTGTCAGG - Intronic
1103949531 12:124543389-124543411 CCACGTGCATCTCCACTGTCCGG + Intronic
1105747695 13:23393089-23393111 CCAGCTGCAAAGCCACGGCAGGG + Intronic
1112409238 13:99147901-99147923 CCACATGCTTACCCACCGTATGG - Intergenic
1117154889 14:52928945-52928967 ACACCTGGAGAGCCAATGTAAGG - Intronic
1122602043 14:102926439-102926461 CATCCTGCAGAGCCACTGTGTGG - Intronic
1125743668 15:41984730-41984752 CCAACTGCTTTGCCAGTGTATGG + Intronic
1130661326 15:85833592-85833614 CCACCTCCAGAGCCCCTGCACGG - Intergenic
1130900988 15:88206731-88206753 CCGCCCGCCTGGCCACTGTAAGG - Intronic
1133247009 16:4455645-4455667 CCACCCGCAGAGCCTCTGGACGG + Exonic
1133398364 16:5466249-5466271 CCCACTGCACAGACACTGTATGG - Intergenic
1137751667 16:50866085-50866107 CCTCCAGCATAGACACTGAATGG + Intergenic
1142696206 17:1635228-1635250 CCACGTGCTCAGCCACTGTCCGG + Exonic
1151577447 17:74959847-74959869 CACCCTGCAAAGCCACTGTGGGG + Intronic
1155399109 18:25418636-25418658 CCACCAGCAAAGCCAGTGGATGG - Intergenic
1157157076 18:45278890-45278912 ACCACTGCACAGCCACTGTATGG + Intronic
1161960679 19:7521253-7521275 CCACTTGTATACCTACTGTATGG - Intergenic
1166185672 19:41137314-41137336 CCACCTGCACAGCCACTGTCTGG + Intergenic
1166700105 19:44877450-44877472 CCACCTGCTCAGCCCCTGCAGGG + Intronic
1168245366 19:55110503-55110525 CCTCCTGCAGAACCACAGTAGGG - Intronic
926196873 2:10769253-10769275 CCACCTGAAGAACCACTGTGTGG + Intronic
931089016 2:58865772-58865794 ACACCTGTATAGCCTCTGAAGGG + Intergenic
932117765 2:69068614-69068636 CCATCTACATAGGCACTGGAAGG + Intronic
941652288 2:168105136-168105158 CAACCTGCCTAACCACTGTCAGG - Intronic
942328053 2:174792092-174792114 CCACCAGCATAGCCTCTGCTGGG - Intergenic
944036962 2:195306406-195306428 CCATCTGCACAGCCACTATTTGG + Intergenic
1170565406 20:17599356-17599378 CCACCTGCTTAGCCAGGGAAGGG + Intronic
1173742794 20:45413397-45413419 CCACCTCCAAAGGCACTGTGTGG - Intergenic
1175692638 20:61076519-61076541 CCTCCTGCAGAGCCTCTGTGGGG - Intergenic
1179960730 21:44765863-44765885 CAACATGCATGGCCACTGCAGGG + Intergenic
1180788158 22:18558399-18558421 CCACCTGCCTATCCACAGCAGGG + Intergenic
1181233580 22:21436919-21436941 CCACCTGCCTATCCACAGCAGGG - Intronic
1181245070 22:21497924-21497946 CCACCTGCCTATCCACAGCAGGG + Intergenic
1182318579 22:29463860-29463882 CCACCTGCAGAGCCGCAGCAGGG - Intergenic
954449477 3:50563915-50563937 CCATCTGCTTACCCACTGCATGG + Intronic
958196264 3:90245595-90245617 ACAGCAGCAGAGCCACTGTAGGG - Intergenic
961968593 3:130933823-130933845 CCACCTCCAAAGCCCCTTTATGG - Intronic
967478165 3:189944602-189944624 TCCCCTGTATAGCTACTGTATGG - Intergenic
973240265 4:47949105-47949127 CCACCTGCATAGCCACTGTATGG - Intronic
976333629 4:83860925-83860947 ACACCTCCAGAGCCACTGTTTGG + Intergenic
977873683 4:102123891-102123913 CCACCTGCTCAGCCACAGTAGGG - Intergenic
987098157 5:14567988-14568010 CCCCCTGCATGGCCACTTCAGGG + Intergenic
987537411 5:19206772-19206794 GCACCTGCAGAGCCACAGTGGGG + Intergenic
988195133 5:27995335-27995357 TCACCTGCATATCCAATGTGAGG - Intergenic
998610071 5:143679189-143679211 CTTCCTGCAGAGCCACTATAGGG + Intergenic
1013458070 6:110350022-110350044 CCACCTGCTTTGCATCTGTAGGG + Intronic
1026535413 7:71234878-71234900 CCTCCTGCATAGTGACTGTTGGG + Intronic
1032632633 7:133670381-133670403 CTAGCTGCCTAGCCAGTGTATGG + Intronic
1037710751 8:21353526-21353548 CCACCTGCTCAGGCACTGTCTGG - Intergenic
1041110375 8:54477449-54477471 CTAACTGCAGAGTCACTGTAAGG + Intergenic
1042233839 8:66588167-66588189 TCACCTGCATACCAACTGAAAGG - Intronic
1044257154 8:90077996-90078018 CCATGTGCTTAGACACTGTATGG + Intronic
1049806602 8:144543790-144543812 CCAGCTGCCTAGCCAATGTGTGG - Intronic
1052258785 9:26491073-26491095 GCACCAGCATAGCCACAGTGGGG - Intergenic
1053404380 9:37859327-37859349 CCACTTTCATAGACACTGTAAGG - Intronic
1055405893 9:75973526-75973548 GCACTAGCATAGCCACTGTGGGG + Intronic
1056121452 9:83492821-83492843 CAACCTTCAGAGTCACTGTATGG + Intronic
1185772134 X:2772929-2772951 TCACCTGCATGGCGACTGTGGGG + Intronic
1186535259 X:10340703-10340725 CCACCCCCATATCCACTGTATGG - Intergenic
1188022190 X:25171259-25171281 CCACTTGCAAAGGCCCTGTATGG + Intergenic
1189242693 X:39537725-39537747 CCACCTGCATAGCCGAGATATGG + Intergenic
1189735138 X:44062526-44062548 ACATCTGCATGGCCACTGAAAGG - Intergenic
1201298510 Y:12486212-12486234 TCACCTGCATGGCGACTGTGGGG - Intergenic