ID: 973240495

View in Genome Browser
Species Human (GRCh38)
Location 4:47951155-47951177
Sequence CTGTTGTTTCGGAGCAAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973240495_973240499 14 Left 973240495 4:47951155-47951177 CCGAGCTTGCTCCGAAACAACAG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 973240499 4:47951192-47951214 TATGCCTAGTGTTTGATTATTGG 0: 1
1: 9
2: 315
3: 262
4: 265
973240495_973240501 30 Left 973240495 4:47951155-47951177 CCGAGCTTGCTCCGAAACAACAG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 973240501 4:47951208-47951230 TTATTGGAACGCTAAGCATGTGG 0: 83
1: 225
2: 230
3: 112
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973240495 Original CRISPR CTGTTGTTTCGGAGCAAGCT CGG (reversed) Intronic
900189714 1:1348255-1348277 CTGCTGTTTCGGGGCAGCCTGGG - Intronic
903624312 1:24720243-24720265 CTGTTGTTCCGGAGCCAGAGAGG + Intergenic
905236568 1:36554190-36554212 CTGTGGGTGCGGAGCAAGCATGG - Intergenic
906005234 1:42463479-42463501 CTGTAGTTTCGGACCATACTGGG - Intronic
909200306 1:72683688-72683710 ATGTTGTTTCTGAGACAGCTGGG + Intergenic
923010627 1:230084807-230084829 CTGTGGTTTGGCAGCATGCTTGG + Intronic
923975076 1:239253819-239253841 ATGTTATTTGGGAGAAAGCTGGG - Intergenic
1064440490 10:15349118-15349140 CTGTGTTTTCACAGCAAGCTAGG + Intronic
1069061126 10:63895510-63895532 CTGCTCTTTAGGAGAAAGCTTGG + Intergenic
1069646985 10:70007509-70007531 CTGTAGTTCCAAAGCAAGCTGGG + Intergenic
1075167913 10:120085760-120085782 CTGTTGTCTTGAAGCAACCTAGG - Intergenic
1081384571 11:42456478-42456500 CTCAAGTTTCAGAGCAAGCTTGG + Intergenic
1084940703 11:72611390-72611412 CTGTTCTTTCTGAGCACCCTAGG - Intronic
1094129401 12:27059331-27059353 CTGCTGTTTTGCAGGAAGCTAGG + Intronic
1098774400 12:74593444-74593466 TTTTAGTTTTGGAGCAAGCTTGG - Intergenic
1103969558 12:124661521-124661543 CTGTTGTCATGGAGGAAGCTGGG - Intergenic
1104348066 12:128020620-128020642 CTGTTGGTTTGGGGCAGGCTGGG + Intergenic
1106414974 13:29538898-29538920 CTCTTGTTTCGGATCTGGCTGGG + Intronic
1106780990 13:33058727-33058749 CTGTTGTTTTGGAACAATCACGG + Intronic
1109600671 13:64623963-64623985 CTGTTGTATGGGAGCAATCTAGG + Intergenic
1116168667 14:41369478-41369500 CTGTAATTTCAGAGCAAGCATGG + Intergenic
1117795305 14:59387835-59387857 TTGTTGTTTGGGAGAAAGCAAGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124864545 15:33476212-33476234 CTGTTGTTTCTAATCTAGCTCGG - Intronic
1126245169 15:46496682-46496704 CTGCTGTTTTGCAGCAAGATAGG + Intergenic
1130401054 15:83554480-83554502 CTGTTGTTTAAGAGCAAGGCTGG - Intronic
1131388221 15:92025525-92025547 TTGTTGTTTTGGAGAATGCTAGG + Intronic
1135594139 16:23728522-23728544 CTGTTGCTTCTGAGCACACTTGG + Intergenic
1157219752 18:45820012-45820034 CTGTTGTTAGTGAGAAAGCTGGG + Intergenic
1164145072 19:22507449-22507471 CTGGAGTTTCAGAGCAGGCTGGG - Intronic
1168417395 19:56177206-56177228 CTGTTGTTTCCGAGGAACTTAGG - Intronic
926144339 2:10387462-10387484 CTGCTGTTTCTGAGCCATCTAGG + Intronic
928619423 2:33073596-33073618 CTGATGTTTCAGAGCAACTTTGG - Intronic
929698423 2:44140491-44140513 CTGTTGTTTAGGAGGGAACTTGG + Intergenic
930203808 2:48568744-48568766 CTGTTGTTCTTGAGCAACCTTGG + Intronic
935735365 2:106102658-106102680 CTGTTGTTTCGAGGCAATCATGG + Intronic
941519803 2:166526911-166526933 CTGTAGCTTTGTAGCAAGCTTGG + Intergenic
1169701193 20:8448617-8448639 CTGTTCTTTCTGAGAAAACTTGG + Intronic
1170285180 20:14699480-14699502 ATTTTGTGTCAGAGCAAGCTGGG + Intronic
1170618521 20:17974500-17974522 CAGTTCTTTCGGAGAAACCTGGG + Intronic
1178934952 21:36853231-36853253 ACGTTATTTCGGAGCGAGCTTGG + Intronic
1182419499 22:30242029-30242051 CTGCTGTGTCGGAGCATGCTGGG + Exonic
1183083310 22:35471137-35471159 CTGCTGTTGCAGAGCAGGCTGGG + Intergenic
952659537 3:35828506-35828528 TGGTTGTTGCTGAGCAAGCTGGG + Intergenic
959887579 3:111520316-111520338 CTGGTGTTAGGGAGCAAGATAGG - Intronic
963299096 3:143578978-143579000 ATATTGTTTCTGAGCAAACTAGG + Intronic
963602988 3:147393321-147393343 CTGCAGCTCCGGAGCAAGCTGGG - Intronic
964428703 3:156580991-156581013 CTGTAGTTTTGAACCAAGCTTGG + Intergenic
969511606 4:7621038-7621060 CTGTGGTCTCAGAGCCAGCTGGG - Intronic
970541280 4:17082365-17082387 CTGGTTTTGCGGAGCCAGCTGGG - Intergenic
970867278 4:20773477-20773499 CTGTTGACTCTGAGCAAGCTGGG + Intronic
970998089 4:22291063-22291085 CTGATGTTTGGCAGCATGCTTGG + Intergenic
972515659 4:39808524-39808546 CTTTTGTTTTGGCGCAATCTCGG + Intergenic
973240495 4:47951155-47951177 CTGTTGTTTCGGAGCAAGCTCGG - Intronic
974313680 4:60247924-60247946 CTGTTGTTTCTGTTGAAGCTTGG + Intergenic
976353992 4:84093836-84093858 CTGTTCTTTCAGAGGCAGCTGGG - Intergenic
978294542 4:107188753-107188775 CTGTGGTTTGAGAGCAACCTAGG + Intronic
988923456 5:35964971-35964993 CTGTGGTTTCGGGGTAAGCAGGG - Intronic
1000984480 5:167851742-167851764 CTCTTGTTTGGGAGGAAGATGGG + Intronic
1002057699 5:176608265-176608287 CTGTTGCTTGGGAGGAACCTTGG - Intronic
1005049662 6:21673241-21673263 CTGATGTTTCAGAGAAAGCAAGG + Intergenic
1008574850 6:52850265-52850287 CTGTTGGTTCAAGGCAAGCTTGG + Intronic
1012810323 6:103948697-103948719 CTGCTTTTCCAGAGCAAGCTTGG + Intergenic
1017871785 6:158493095-158493117 CTGTTGCCTTGGAGCAAGCGTGG - Intronic
1026139847 7:67696415-67696437 CTCTTGTTTCGGGGCCAGGTGGG + Intergenic
1026207337 7:68269510-68269532 CTGTTCTTTTGCAGCAACCTGGG - Intergenic
1038307887 8:26421121-26421143 CTGTAATTCCGAAGCAAGCTAGG - Intronic
1058559563 9:106211762-106211784 TTGTTGTTTTGGAGCCATCTAGG + Intergenic
1058732015 9:107859454-107859476 CTGTTTCTTCCAAGCAAGCTGGG - Intergenic
1061969920 9:134039467-134039489 CAGCTGTGTGGGAGCAAGCTTGG - Intronic
1202012603 Y:20361312-20361334 CTGTTCTTTTTGAGAAAGCTAGG + Intergenic