ID: 973240755

View in Genome Browser
Species Human (GRCh38)
Location 4:47953872-47953894
Sequence CCGAGTGTGGAGCCCTCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 10, 2: 55, 3: 136, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973240755_973240760 -8 Left 973240755 4:47953872-47953894 CCCGGCGAGGGCTCCACACTCGG 0: 1
1: 10
2: 55
3: 136
4: 338
Right 973240760 4:47953887-47953909 ACACTCGGGCCTTATGCCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 64
973240755_973240768 24 Left 973240755 4:47953872-47953894 CCCGGCGAGGGCTCCACACTCGG 0: 1
1: 10
2: 55
3: 136
4: 338
Right 973240768 4:47953919-47953941 CCTCGGACCTAAGTGAAAACAGG 0: 1
1: 1
2: 12
3: 80
4: 264
973240755_973240762 7 Left 973240755 4:47953872-47953894 CCCGGCGAGGGCTCCACACTCGG 0: 1
1: 10
2: 55
3: 136
4: 338
Right 973240762 4:47953902-47953924 GCCCTCGGACCTTATGCCCTCGG 0: 1
1: 0
2: 0
3: 14
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973240755 Original CRISPR CCGAGTGTGGAGCCCTCGCC GGG (reversed) Intronic
900216897 1:1486451-1486473 TGGAGTGTGGAGCCCCTGCCGGG - Intronic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
905526253 1:38642151-38642173 CTGAGGGTGGAGCCCTCGCCAGG + Intergenic
905558770 1:38909263-38909285 CTGGGGGTGGAGCCCTAGCCAGG + Intronic
905897438 1:41557894-41557916 GCAAGTGAGGAGCCCTCGCTGGG - Intronic
906686283 1:47765464-47765486 CCGACTGTGGGGCCCTCAGCAGG - Exonic
906751694 1:48268174-48268196 CCAAGGGTGGAGCCCTTGCCAGG + Intergenic
906953154 1:50350492-50350514 CTGAGGGTGGAGCCCTCACCAGG - Intergenic
907706839 1:56839722-56839744 TTGAGGGTGGAACCCTCGCCAGG + Intergenic
908269841 1:62412020-62412042 CTGAGGTTGGAGCCCTCTCCAGG - Intergenic
908702735 1:66919990-66920012 TTGAGGGTGGGGCCCTCGCCAGG - Intronic
908892838 1:68864774-68864796 CCGAGGGTGGAGCCCTTGGCAGG + Intergenic
909917348 1:81336762-81336784 TCGAGGGTGGGGCCCTCACCGGG - Intronic
910478565 1:87634351-87634373 CATGGGGTGGAGCCCTCGCCAGG + Intergenic
911429968 1:97773423-97773445 CCGAGGGTAGAACCCTCACCGGG - Intronic
911587147 1:99704502-99704524 TTGGGGGTGGAGCCCTCGCCAGG - Intergenic
911764512 1:101657390-101657412 TCGAGGGTGGAGCCCTCGCCAGG + Intergenic
912002830 1:104856374-104856396 CCGAGGGTGGAGCCCTCTCCAGG + Intergenic
912504978 1:110150291-110150313 CAGACCCTGGAGCCCTCGCCAGG - Intergenic
912709173 1:111937539-111937561 CCCAGTGTGGAGCAGTCCCCTGG - Intronic
914995919 1:152543357-152543379 CTGAGGGTGGAGCCCTCACCAGG - Intronic
917254934 1:173103976-173103998 CCGAGTGCGGAGCCCTCACCAGG + Intergenic
918719653 1:187836792-187836814 CCGAGGGTGGAGCCCTAGCGAGG + Intergenic
918813285 1:189149626-189149648 CCGAAGGCGGAGCCCTAGCCGGG - Intergenic
918926545 1:190793314-190793336 CCGAGGGTGGAGCTCCCGCCAGG + Intergenic
919110945 1:193217777-193217799 ATGAGGGTGGAGCCCTAGCCAGG + Intronic
919314518 1:195954511-195954533 TCGAGGGTGGGTCCCTCGCCAGG - Intergenic
921403476 1:214753147-214753169 CTCAGGGTGGAGCCCTCACCAGG - Intergenic
921893988 1:220380029-220380051 CTGGGGGTGGAGCCCTCGCCAGG + Intergenic
921991617 1:221372981-221373003 CCGAGGGTGGAGCCCTCACCAGG + Intergenic
922818739 1:228469993-228470015 CCCAGGCTGGTGCCCTCGCCCGG - Intergenic
922962068 1:229656042-229656064 CCGGGTGTGGAGCCCACACCTGG + Intronic
923109991 1:230882830-230882852 CTGGGGGTGGAGCCCTAGCCAGG + Intergenic
1064680494 10:17806730-17806752 CCGAGGGTGGAGCCCTCGCCAGG + Intergenic
1064795877 10:19010365-19010387 CCAAGAGTAGAGCCCTCACCAGG + Intergenic
1066298937 10:34079942-34079964 CCAAGTGAGGAGCCCTTCCCAGG + Intergenic
1067850226 10:49749877-49749899 CCCACTGTGGAGGCCTGGCCTGG + Intronic
1068196784 10:53727274-53727296 CTGAGGGTGGAGCCCTCACCAGG + Intergenic
1068407118 10:56604611-56604633 CTGAGGGTGGAGCCCTCACCAGG - Intergenic
1068607851 10:59025922-59025944 CTGGGGGTGGAGCCCTCCCCAGG - Intergenic
1069352863 10:67551000-67551022 CTGGAGGTGGAGCCCTCGCCAGG - Intronic
1071195358 10:83153284-83153306 CTGAGGGTGGAGCCTTGGCCAGG - Intergenic
1071486784 10:86107527-86107549 CAGGGAGTGGAGCCCTAGCCAGG - Intronic
1071819350 10:89264509-89264531 CCAAGTGTGCAGCCCTCAGCAGG + Intronic
1071867108 10:89746672-89746694 CCGAGGGTGGAGCCTTCACCAGG + Intronic
1071893859 10:90042319-90042341 CCCAGTGTGGAGCCCTTGCCAGG + Intergenic
1073300455 10:102468070-102468092 CCAGGGGTGGAGCCCTAGCCAGG + Intronic
1073762769 10:106648744-106648766 CCAGGGGTGGAGCCCTAGCCAGG - Intronic
1073855857 10:107672619-107672641 CCAAGAGTGGAGCCCTGGCCAGG - Intergenic
1074096445 10:110317827-110317849 CCGAAGGTGGAGCCCTCACCAGG - Intergenic
1074178019 10:111030351-111030373 CCGAGGGTAGAGCCCTTGCCGGG + Intergenic
1074710004 10:116169373-116169395 TTGAGGGTGGAGCCCTCGCCAGG - Intronic
1075182639 10:120225541-120225563 CTGAGGGTGGAGCCCTCACCAGG + Intergenic
1075742442 10:124704094-124704116 CCGAGGGAGGAGCCCTACCCGGG - Intronic
1076999525 11:315739-315761 CCGAGGGTGGGGCGCTCGCGAGG + Intergenic
1077111525 11:864199-864221 CTGAGTGTGGGGCCCTGGGCTGG - Intronic
1077586767 11:3459723-3459745 CCTGGGGTGGAGCCCTAGCCAGG + Intergenic
1078113993 11:8426492-8426514 CTGGGGGTGGAGCCCTAGCCAGG + Intronic
1078345668 11:10545297-10545319 TGGAGTGTGCAGCCCTGGCCAGG + Intergenic
1078736418 11:14024746-14024768 CCAAGGGTGGAGCCCCTGCCAGG + Intronic
1081075522 11:38668151-38668173 CTGAGGTTGGAGCCCTGGCCAGG + Intergenic
1081462667 11:43286380-43286402 CCGAGGGTGGATCCCTCACCAGG - Intergenic
1081747332 11:45482395-45482417 CTAGGTGTGGAGCCCTCACCTGG - Intergenic
1082710304 11:56546969-56546991 CTGTGGGTGGAGCCCTCACCAGG - Intergenic
1083388924 11:62333866-62333888 CCAGGGGTGGAGCCCTAGCCAGG + Intergenic
1083900466 11:65640939-65640961 CGGTGTGGGGAGCCCTCGGCGGG + Exonic
1084206134 11:67594188-67594210 CTGGGGGTGGAGCCCTAGCCAGG + Intergenic
1084231553 11:67757213-67757235 CCGAGGGCAGAGCCCTCGCTAGG - Intergenic
1084242765 11:67833756-67833778 CCTGGAGTGGAGCCCTAGCCAGG + Intergenic
1084830236 11:71763224-71763246 CCTCGGGTGGAGCCCTAGCCAGG - Intergenic
1085315738 11:75543820-75543842 CCTGGGGTGGAGCCCTAGCCAGG + Intergenic
1085887083 11:80533579-80533601 CCAAGGGTGGAGCCCTAGCCAGG + Intergenic
1086001745 11:81992393-81992415 CCGGGGGTGGAGCCCTTGCCAGG - Intergenic
1086311442 11:85540155-85540177 CCAAGGGTGGATCCCTCACCAGG - Intronic
1086395769 11:86413441-86413463 CCTAGGGTGGAGCCCTAGCCAGG + Intronic
1087140068 11:94756311-94756333 CCGAGGATGGAGCCCTTGCCAGG + Intronic
1087396675 11:97609457-97609479 CTGAGGGTGGAGCCCTCACCAGG + Intergenic
1087397035 11:97611705-97611727 CCAAGGGTGGAGCCTTTGCCAGG + Intergenic
1087461483 11:98453760-98453782 CCGGGAGTGGAGCCCTAGCCAGG + Intergenic
1087462013 11:98457112-98457134 CCGGGGGTGGAGCCCTAGCCAGG + Intergenic
1087475089 11:98624134-98624156 CTGAGGGTGGACCCCTAGCCAGG + Intergenic
1087677027 11:101175348-101175370 CCAAGGGTGGAGCCCTCGCCAGG - Intergenic
1087753217 11:102028373-102028395 TTGAGGGTGTAGCCCTCGCCAGG - Intergenic
1087816411 11:102663886-102663908 CCAAGGGTGGAGCCCTCGCCAGG - Intergenic
1087991212 11:104746784-104746806 CCGAGGGTGGAGCCCTCGCCAGG - Intergenic
1088221079 11:107570450-107570472 CTGGGGGTGGAACCCTCGCCAGG + Intergenic
1088257689 11:107916466-107916488 CCCAGGGTGGAGCCCTTGCCAGG - Intronic
1088507375 11:110539655-110539677 CCGAGGGTGGAGCCCTTGCCAGG + Intergenic
1088746327 11:112807834-112807856 CCCAGTTTGGAGCCCTTGCAAGG - Intergenic
1089196740 11:116697906-116697928 CTGAGTGTGAAGCCCTGTCCTGG - Intergenic
1090124355 11:124070203-124070225 CCAGGGGTGGAGCCCTCCCCAGG + Intergenic
1090458025 11:126866528-126866550 CAGAGGGTGGAGCCCCCCCCAGG - Intronic
1092413003 12:8268456-8268478 CCTGGGGTGGAGCCCTAGCCAGG + Intergenic
1092569931 12:9710506-9710528 GTGAGTGTGGAGCCCTAGCCAGG - Intergenic
1092598736 12:10035337-10035359 CCGGGGGTGGAGCCCTCGCCAGG + Intronic
1093692307 12:22122083-22122105 CCGAGGGTGAAGCCCTCGCCAGG + Intronic
1093712133 12:22339607-22339629 CTGAGGGTGGAGCCATCTCCAGG - Intronic
1093943904 12:25085678-25085700 CTGAGGGTGGAGCCCTCACTGGG + Intronic
1094361681 12:29638093-29638115 CTGAGGGTAGAGCCCTAGCCAGG - Intronic
1096171596 12:49476010-49476032 CCCAGGATGGAGCCCTAGCCAGG - Intronic
1098396920 12:70028967-70028989 CCGAGGGTGAAGCCCTTGCCTGG + Intergenic
1098545670 12:71708174-71708196 TTGAGGGTGGAGCCCTCACCAGG + Intergenic
1098697748 12:73581078-73581100 CCGAGGGTGGAGCCCTCGCCAGG - Intergenic
1099055458 12:77834190-77834212 CCAGGGGTGGAGCCCTAGCCAGG + Intronic
1099653217 12:85456420-85456442 CTGAGGGTGGAGCCCTCACCAGG - Intergenic
1100329775 12:93571992-93572014 CCGAGCGCGCAGCCCTCGCGGGG - Exonic
1101379901 12:104205392-104205414 CTGAGGGTGGAGCCCTCGCCAGG + Intergenic
1101455697 12:104827946-104827968 CTGGGGGTGGAGCCCTAGCCAGG - Intronic
1102087001 12:110149979-110150001 CTGGGGGTGGAGCCCTCACCAGG + Intronic
1102235425 12:111291496-111291518 CGAAGTGTGGAGGTCTCGCCGGG - Exonic
1105245205 13:18643957-18643979 CTGAGTGAGGCGCCCTCTCCTGG - Intergenic
1105673483 13:22644826-22644848 ATGAGGGTGGAGCCCTAGCCAGG + Intergenic
1105682704 13:22745365-22745387 CCAGTGGTGGAGCCCTCGCCGGG + Intergenic
1106016106 13:25870394-25870416 CTGGGGGTGGAGCCCTAGCCAGG + Intronic
1106173576 13:27309306-27309328 GTGGGTGTGGAGCCCTAGCCAGG + Intergenic
1106561116 13:30847092-30847114 CTGAGTGTGTAGCCCTCATCTGG + Intergenic
1106622626 13:31385686-31385708 CTGGGAGTGGAGCCCTAGCCAGG + Intergenic
1107125402 13:36840461-36840483 CCGAGCGTGGAGCCCTCGCCTGG + Intergenic
1109140722 13:58711724-58711746 CCAGGGGTTGAGCCCTCGCCAGG - Intergenic
1109152508 13:58861286-58861308 CCAGGGGTGGAGCCCTAGCCAGG + Intergenic
1109172951 13:59118328-59118350 CCAGGGGTGGAGCCCTAGCCAGG + Intergenic
1110385640 13:74907198-74907220 CCGAGGGTGGAGCCCTTGCCAGG + Intergenic
1110661763 13:78065830-78065852 CCAGGAGTGGAGCCCTCACCAGG - Intergenic
1110964584 13:81676481-81676503 CCAAGGGTGGAGCCCTTGCCAGG + Intergenic
1111206664 13:85020113-85020135 CCGAGGCTGGAGCCCTTGCCAGG - Intergenic
1111405144 13:87793732-87793754 CCGAGGGTGGAGCCTTTGCCAGG + Intergenic
1111584640 13:90268574-90268596 CTGGGGGTGGAGCCCTCGCCAGG + Intergenic
1112705214 13:102060743-102060765 CCGAGGGTGGAGCCCTCGCCAGG - Intronic
1112929181 13:104713715-104713737 CCAAGGGTGGAGCCCTCACCAGG - Intergenic
1113839308 13:113349763-113349785 AGGAGTGTGGAGCCCCTGCCTGG - Intronic
1114231834 14:20790361-20790383 CCGGAGGTGGAGCCCTAGCCAGG - Intergenic
1115573959 14:34693269-34693291 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
1116090122 14:40294042-40294064 CTGAGGGTTGAGCCCTTGCCAGG + Intergenic
1116298404 14:43142061-43142083 CGGAGGATGGAGCCCTAGCCAGG + Intergenic
1116345437 14:43786787-43786809 CTGAGGGTAGAGCCCTAGCCAGG + Intergenic
1117046303 14:51816690-51816712 CTGAGGGTGGAGCCCTGGCCAGG + Intergenic
1118400251 14:65373215-65373237 TTGAGGGTGGAGCCCTCGCCAGG - Intergenic
1118487126 14:66224763-66224785 CCAAGGGTGGAGCCCTCATCAGG - Intergenic
1118667522 14:68086496-68086518 CTGGGGGTAGAGCCCTCGCCAGG + Intronic
1119562625 14:75603173-75603195 TTGAGGGTGGGGCCCTCGCCAGG - Intronic
1120211963 14:81642007-81642029 CCGAGGGTGGAGCCCTTGCCAGG + Intergenic
1120474521 14:84970159-84970181 TTGAGGGTGGAGCCCTCGCCAGG + Intergenic
1120855094 14:89205363-89205385 CCAAGGGTGGAGCCCTCGCCAGG - Intronic
1121911656 14:97797448-97797470 GGGAGTGTGGAGCCCTGGCTGGG - Intergenic
1123809140 15:23905586-23905608 CCAGGAGTGGAGCCCTAGCCTGG + Intergenic
1123824079 15:24063411-24063433 CCAGGGGTGGAGCCCTAGCCTGG + Intergenic
1123964234 15:25439070-25439092 CCCGGCCTGGAGCCCTCGCCCGG - Intergenic
1124405206 15:29385724-29385746 CTGAGGGTGGAGCCCTCGCCAGG - Intronic
1125446844 15:39767473-39767495 CCAAGGGTGGAGCCCTCGCCAGG - Intronic
1127790210 15:62391920-62391942 CCGAGTGTAGAGCGTTCTCCCGG + Intronic
1128501454 15:68229833-68229855 GCGAGTGTGGCGTCCTCGCGGGG + Intronic
1129683404 15:77671161-77671183 CTGACTGTGGAGCCCTACCCAGG + Intronic
1129903009 15:79166141-79166163 CAGAATCTGGAGCCCTGGCCTGG + Intergenic
1130430374 15:83841689-83841711 CCAAGGGCGGAGCCCTAGCCAGG - Intronic
1130682772 15:86010839-86010861 CCAGGGGTGGAGCCCTAGCCAGG + Intergenic
1130927412 15:88396018-88396040 CCGGGAGTGGAGCCCTAGCCAGG + Intergenic
1131557814 15:93414579-93414601 CTGAGGGTGGAGCCCTCGCCAGG + Intergenic
1132566786 16:627237-627259 AGGAGTGTGGAGACCCCGCCAGG + Intronic
1133755768 16:8761344-8761366 CCGCGTGTGGAACCCTTCCCTGG + Intronic
1134602384 16:15543415-15543437 TTGAGGGTGGAGCCCTCACCTGG + Intronic
1136588343 16:31202128-31202150 CTGGGTGTGGAGGCCTCACCTGG + Exonic
1138808425 16:60120647-60120669 CCGGGAGTGGAGCCCTAGCCAGG - Intergenic
1139017794 16:62711375-62711397 CTGAGGGAGGGGCCCTCGCCAGG - Intergenic
1140748189 16:77999465-77999487 CCAAGAGTGGAGCCCTCACCAGG + Intergenic
1143002061 17:3800745-3800767 CTGAGTGTGGAGGCTCCGCCTGG - Intronic
1143290352 17:5823360-5823382 GTGAGGGTGGAGCCCTAGCCAGG + Intronic
1144300802 17:13921879-13921901 CTGAGGGTGGAGACCTAGCCAGG - Intergenic
1144302802 17:13938773-13938795 CTGAGGGTGGAGCCCTCCCTAGG - Intergenic
1148892905 17:50820640-50820662 ACGAGGGTGGAGCCCTCGCCAGG - Intergenic
1149217157 17:54370541-54370563 CCCAGGGTGGAGCCCTTGCCAGG + Intergenic
1149882540 17:60307688-60307710 CTGAGGGTGGAGCCCTAGCCAGG - Intronic
1150782437 17:68134342-68134364 CCAAGTGTGGAGCCCTGCTCAGG + Intergenic
1150998970 17:70351814-70351836 CCGAAGGTGGAGCCCTTACCAGG - Intergenic
1151533250 17:74721213-74721235 TTGAGGGTGGAGCCATCGCCAGG + Intronic
1154443742 18:14415974-14415996 CTGAGTGAGGCGCCCTCTCCTGG + Intergenic
1155683623 18:28520439-28520461 TTGAGGGTGGAGCCCTCGCCAGG - Intergenic
1156514869 18:37671062-37671084 TCGAGGGTGGCACCCTCGCCAGG - Intergenic
1156657705 18:39308626-39308648 CCGAGAGTGGAGCCCTAGCTGGG - Intergenic
1157002427 18:43542649-43542671 CAGAGCTTGGAGCCCTCCCCAGG + Intergenic
1157498122 18:48170890-48170912 GGGAGTGTGGTGCCTTCGCCAGG + Intronic
1157535093 18:48452108-48452130 CTGGGGGTGGAGCCCTTGCCAGG + Intergenic
1158188342 18:54796809-54796831 CCGAGGGTGGACCCCTAGACTGG + Intronic
1158856167 18:61544836-61544858 CAGAGGATGGAGCCCTCACCAGG + Intronic
1159215183 18:65383594-65383616 CCAAGGGTAGAGCCCTCGCCAGG - Intergenic
1159379456 18:67637362-67637384 TCGAGGGTGGAGCCCTCACCAGG + Intergenic
1161494603 19:4580528-4580550 CCGAGTGTGGCCCCCTCCCGCGG - Intergenic
1163602449 19:18257264-18257286 CCGGGTATGGTGGCCTCGCCAGG + Exonic
1163617022 19:18335417-18335439 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
1163837223 19:19582238-19582260 CCGAGGGTGGAGCCCTCGCCAGG - Intronic
1165295903 19:34925701-34925723 CCAGGGGTGGAGCCCTAGCCAGG + Intergenic
1165532862 19:36418548-36418570 CCGAGTGAGCAGTCCTGGCCCGG - Exonic
1166246993 19:41536451-41536473 CCAGGTTTGGAGCCCTAGCCAGG - Intergenic
1166635932 19:44452060-44452082 CTGAGTGTGGAGTCCTCAGCAGG + Intergenic
1168184669 19:54691936-54691958 GTGAGGGTGGAGCCCTAGCCAGG + Intronic
1168719043 19:58544821-58544843 CCGCCAGCGGAGCCCTCGCCCGG - Exonic
925049236 2:798237-798259 CCGAGGGTGGAGCCCTCACTGGG + Intergenic
925092449 2:1166638-1166660 CTGGGGGTGCAGCCCTCGCCAGG - Intronic
925311917 2:2890859-2890881 CCTCCTGTGGAGCCCTCTCCAGG - Intergenic
925572403 2:5325889-5325911 CCTGGGGTGGAGCCCTTGCCAGG + Intergenic
925839743 2:7980182-7980204 CCAGGGGTGGAGCCCTAGCCAGG - Intergenic
925904249 2:8529809-8529831 CTGAGTGTGGAGCTCTCGGGAGG - Intergenic
926139192 2:10358394-10358416 CCAGGGGTGGAGCCCTCGACAGG - Intronic
926684620 2:15689490-15689512 CCGAGTGAGGAGCCCCACCCTGG - Intergenic
926961763 2:18365034-18365056 CCGGGGGTGGAGCCCTAGCGAGG + Intergenic
927583955 2:24282025-24282047 CCGAGGCTGAAGCCCTAGCCAGG - Intronic
928537991 2:32258467-32258489 CTGGGGGTGGAGCCCTTGCCAGG + Intronic
929726047 2:44428530-44428552 TCGAGGGTGGAACCCTCGCCAGG + Intronic
930533141 2:52615143-52615165 TTGAGTGTGGAGCCCTCGCCAGG - Intergenic
930763578 2:55061782-55061804 CCGGGGGTGGAGCCCTCGCCAGG - Intronic
931034808 2:58227779-58227801 CCGGGGGTGGAGCCCTCACCAGG + Intronic
931881781 2:66576686-66576708 CCGAGTCTGGAGCCGCAGCCGGG + Intergenic
933140951 2:78792537-78792559 CTGAGGGTGGAGCCCTCCCCAGG + Intergenic
933250691 2:80025277-80025299 TTGAGGGTGGAACCCTCGCCAGG + Intronic
933315180 2:80706604-80706626 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
933427105 2:82126880-82126902 TTGAGGGTGGAACCCTCGCCAGG + Intergenic
934956991 2:98631365-98631387 CCGAGGTTGGAGCTCTAGCCAGG - Intronic
935261071 2:101356346-101356368 TTGAGGGTGGAGCCCTTGCCAGG + Intronic
935664077 2:105494901-105494923 CCCCGGGTGGAGCCCTCACCAGG + Intergenic
935882154 2:107575615-107575637 CCGAGGGTGGAGTCTTAGCCAGG - Intergenic
935958119 2:108398932-108398954 TTGAGGGTGGAGCCCTCACCAGG - Intergenic
936647497 2:114388780-114388802 TTGAGGGTGGAGCCCTCACCAGG - Intergenic
937448253 2:121976486-121976508 CAGTGTGTGGAGCCTTCACCAGG - Intergenic
938030175 2:127985668-127985690 CTGGGGGTGGAGCCCTCACCAGG - Intronic
938305788 2:130253198-130253220 CAGAGTGTGCAGCCCTGGCAGGG + Intergenic
939451099 2:142376040-142376062 CCGAGGGTGGAGCCCTTGCCAGG - Intergenic
940404761 2:153287891-153287913 CCGAGGGTGGAGCCCTCACCAGG + Intergenic
941427643 2:165368434-165368456 TTGAGGGTGGAGCCCTCGCCAGG + Intronic
942983112 2:182106188-182106210 CCGAGGGTGGAGCCCTTGCTAGG - Intronic
943404346 2:187461503-187461525 CAGAGGGTGAAGCCCTAGCCAGG - Intergenic
943520967 2:188949083-188949105 TTGAGGGTGGAGCCCTCACCAGG - Intergenic
943838977 2:192552879-192552901 CCAAGGGTGGAGCCCTCACTAGG + Intergenic
944058735 2:195549009-195549031 TTGAGGTTGGAGCCCTCGCCAGG + Intergenic
944306811 2:198188531-198188553 CTGAGGGTGGAGCCCTCATCAGG - Intronic
946210531 2:218143842-218143864 CCCAGTGTGGAGCCCTCACCAGG + Intergenic
946621402 2:221567753-221567775 ACCGGTGTGGAGCCCACGCCAGG + Intronic
947519019 2:230829517-230829539 CCAAGTGGGGAGTCCACGCCTGG - Intergenic
947740792 2:232483939-232483961 CTGAGGGTGGAGCCCTCCCGAGG - Intronic
947906433 2:233766574-233766596 CTGGGGGTGGAGCCCTCGCCAGG + Intronic
948525276 2:238567393-238567415 CCGGGGGTGGAGCCCTCACCAGG - Intergenic
948766004 2:240219412-240219434 ATGAATGTGGAGCCCTCGTCGGG - Intergenic
1168823273 20:791667-791689 CCAAGGGTGGAGCCCTCACCAGG - Intergenic
1169503627 20:6184977-6184999 CTAAGGGTGGAACCCTCGCCAGG + Intergenic
1169663300 20:8005489-8005511 CCGAGGGTGGAGCCCTCTCCAGG - Intronic
1169902022 20:10562639-10562661 CCAAGGGTGGAGCCCTCACCAGG + Intronic
1170486042 20:16817049-16817071 CCGGGGGTGGAGCTCTAGCCAGG + Intergenic
1171403318 20:24893107-24893129 CCCAGGGTGGGGTCCTCGCCTGG + Intergenic
1175921754 20:62453470-62453492 AGAAGTGTGGAGCCCTGGCCTGG + Intergenic
1176071886 20:63231238-63231260 CTGTGCGTGGAGCCCTAGCCAGG + Intergenic
1176107167 20:63394886-63394908 CTCAGGGTGGAGCCCCCGCCTGG - Intergenic
1176452346 21:6875250-6875272 CTGAGTGAGGCGCCCTCTCCTGG - Intergenic
1176695546 21:9972772-9972794 TTGAGGGTGGAGCCCTTGCCAGG + Intergenic
1176830518 21:13740299-13740321 CTGAGTGAGGCGCCCTCTCCTGG - Intergenic
1177339466 21:19781778-19781800 TTGAGAGTGGAGCCCTCACCAGG - Intergenic
1177844104 21:26268424-26268446 CTGAGAGTGAAGCCCTCACCAGG + Intergenic
1178178310 21:30130011-30130033 TTGAGGGTGGAGCCCTCGCCAGG + Intergenic
1178384468 21:32138114-32138136 CCGAGGGTGGAGCCCTCACCAGG - Intergenic
1178422422 21:32453038-32453060 CCATGGGTGGAGCCCTCGCCAGG + Intronic
1179524313 21:41965811-41965833 CCGAGTGCTGAGCCAGCGCCAGG + Intergenic
1179607308 21:42525102-42525124 CGGAGGGTGGAGCCCTGGCGAGG + Intronic
1179781028 21:43701145-43701167 CCGAGGATGGGGCCCTCACCTGG - Intergenic
1180135529 21:45859659-45859681 CCGAGTGTGGAGCCCGCTCTGGG - Intronic
1180135559 21:45859786-45859808 CCGGGTGTGGAGACCAGGCCTGG - Intronic
1180969745 22:19809026-19809048 CCGGGGGTGGAGCCCTTGCCAGG - Intronic
1181268395 22:21644137-21644159 CCTAGTGTGGAGCCCTCTGCAGG + Exonic
1183119615 22:35720196-35720218 CCGAGGGTGGAACCCTCACCGGG + Intronic
1183352826 22:37343497-37343519 CCGACAGTGGAGCCCAGGCCGGG - Intergenic
1185041743 22:48507770-48507792 CCGTGTGAGGAGCCCCTGCCTGG + Intronic
1185127135 22:49017558-49017580 CCTGGGGTGGAGCCCTAGCCAGG + Intergenic
949089653 3:11989-12011 CCGAGGTTGTAGCCCTTGCCAGG + Intergenic
949617572 3:5770627-5770649 CCGAGGGTGGAGCCCTCACCAGG + Intergenic
949806331 3:7959481-7959503 CAGGGTGTGGAGCCCTCGCCAGG + Intergenic
949807971 3:7976410-7976432 CTGAGGGTGGAGCCCTTGCCAGG - Intergenic
950465820 3:13153136-13153158 CTGAGAGAGGAGCCCTAGCCTGG - Intergenic
950930364 3:16783265-16783287 ATGAGGGTGGAGCCCTCACCAGG - Intergenic
951549323 3:23861451-23861473 CCGGGGGTGGAGCCCTCGCCAGG - Intronic
952003045 3:28808920-28808942 CCAAGGGTGGAGCCCTTGCCAGG + Intergenic
952003396 3:28811180-28811202 CTGAGGGTGGAGCCCTTGCCAGG + Intergenic
952080545 3:29752435-29752457 TTGAGGGTGGAGCCCTCGCCGGG + Intronic
952109722 3:30108799-30108821 TTGATGGTGGAGCCCTCGCCAGG - Intergenic
952561720 3:34603360-34603382 TTGAGGGTGGAGCCCTTGCCAGG - Intergenic
954109321 3:48425350-48425372 CCGAGTGTGAAGCCGGGGCCTGG + Intronic
955480510 3:59385077-59385099 CCGGGGGTGGAACCCTCACCAGG - Intergenic
956216802 3:66857873-66857895 CTGAGGGTGGAGCCCTAGCCAGG - Intergenic
956390772 3:68770800-68770822 CCGAGGGTGGAGCCCTCGCCGGG - Intronic
957029332 3:75221708-75221730 CTGAGAGTGGAGCCCTTGCCAGG + Intergenic
957048093 3:75392062-75392084 CCAAGGGTGGAGCCCTAGCCAGG - Intergenic
957547805 3:81663147-81663169 ATGAGAGTGGAGCCCTAGCCAGG - Intronic
957758345 3:84522444-84522466 CTGAGGGTGGAGCCCTCGCCAGG - Intergenic
958002009 3:87762167-87762189 TCGAGAGTGGAGCCCTCGCCAGG + Intergenic
958978750 3:100696764-100696786 CCCAGGGTGGAGCCCTCACCAGG - Intergenic
959369457 3:105504825-105504847 CTGGGGGTGGAGCCCTAGCCAGG + Intronic
959420052 3:106117594-106117616 TGGAGGGTGGAGCCCTCACCAGG + Intergenic
959583369 3:108004068-108004090 CCAAGGGTGGAGCCCTAGCCAGG - Intergenic
959723360 3:109516371-109516393 TTGAGGGTGGAGCCCTCGCCAGG + Intergenic
960024018 3:112988149-112988171 CCGGGGGTGGAGCTCTAGCCAGG + Intergenic
960501670 3:118445364-118445386 CTGAGGGTGGAGCCTTTGCCAGG + Intergenic
960613784 3:119579364-119579386 CTGAGTGTGCCGCCCTTGCCAGG - Exonic
961454199 3:127016193-127016215 GTGGGTGTGGAGCCCTGGCCAGG + Intronic
961880165 3:130056172-130056194 CCGAGGGCAGAGCCCTCGCGAGG - Intergenic
961890564 3:130127110-130127132 CCTGGAGTGGAGCCCTAGCCAGG + Intergenic
962095186 3:132285551-132285573 CTGGGGGTGGAGCCCTCGCCAGG + Intergenic
962273078 3:133992492-133992514 TTGAGGGTGGGGCCCTCGCCAGG - Intronic
962917193 3:139915132-139915154 CCAACTGTGGAGCCCTGGCCTGG - Intergenic
963239931 3:142992721-142992743 CCGGGGGTGGAGTCCTCACCAGG + Intronic
965420906 3:168456686-168456708 CCAAGGGTGGAGGCCTCACCAGG + Intergenic
968992552 4:3924519-3924541 CCGAGGGTGGAGCGCTTGCCAGG - Intergenic
969752055 4:9119011-9119033 CCTGGGGTGGAGCCCTAGCCAGG - Intergenic
969811969 4:9655286-9655308 CCTGGGGTGGAGCCCTAGCCAGG - Intergenic
970054716 4:11957602-11957624 CCGGGGGTGGAGCCCTAGTCAGG + Intergenic
970574299 4:17412362-17412384 CTGAGGGTTGAGCCCTTGCCAGG + Intergenic
971025072 4:22581891-22581913 CCAAGGGTGGGGCCCTCTCCAGG - Intergenic
971787564 4:31124149-31124171 TCGAGGGTGGAGCCCTCACCAGG + Intronic
971873740 4:32276689-32276711 TTGAGGGTGGAGCCCTCACCAGG + Intergenic
971887654 4:32473734-32473756 CTGAGTGTGGAGCTCTTGCCAGG + Intergenic
972017063 4:34260997-34261019 CTGTGTGTGGAGACCTTGCCTGG - Intergenic
972104355 4:35463200-35463222 CTGAGGGTGGAGCCCTCGCCAGG - Intergenic
972918379 4:43906799-43906821 CCTAGGGTGGAGCCCTCACCAGG - Intergenic
972940143 4:44185967-44185989 CCGAAGGTGGAGACCTCGCCAGG - Intronic
973057508 4:45679127-45679149 CTGGGGGTGGAGCCCTAGCCAGG + Intergenic
973240755 4:47953872-47953894 CCGAGTGTGGAGCCCTCGCCGGG - Intronic
974250149 4:59375246-59375268 CTGGGGGTGGAGCCCTAGCCAGG + Intergenic
974596334 4:64017665-64017687 CTGAAGGTGGAACCCTCGCCAGG + Intergenic
974975047 4:68881214-68881236 CCAAGGGTGGAGCCCTTGCCAGG + Intergenic
976219728 4:82746788-82746810 CCAAGGGTGGAGCCCTTGCCAGG - Intronic
976802388 4:89007063-89007085 TTGAGGGTGGAGCCCTCACCAGG + Intronic
977045247 4:92061131-92061153 CCAAGGGTGGAGCCCTCACCAGG + Intergenic
977721546 4:100244992-100245014 TTGAGGGTGGAGCCCTTGCCAGG + Intergenic
978310195 4:107378986-107379008 CCGAGGATGGAACCCTTGCCAGG + Intergenic
978327344 4:107574757-107574779 CCAGGGATGGAGCCCTCGCCAGG - Intergenic
978414709 4:108463393-108463415 CCAAGGGTGGTGCCCTCGCCAGG - Intergenic
978703323 4:111675243-111675265 CCGAGGGTGGAGCCCTAGCCAGG - Intergenic
979140105 4:117162191-117162213 TGGGGGGTGGAGCCCTCGCCAGG - Intergenic
979846686 4:125522636-125522658 TTGAGGGTGGAGCCCTCACCAGG - Intergenic
979859456 4:125676114-125676136 CTGAGGGTGGATCCCTCGTCAGG - Intergenic
980337978 4:131500342-131500364 CCGAGGGTGGATCCCTCGCCAGG + Intergenic
980368172 4:131833020-131833042 TTGAGGGTGGAGCCCTTGCCAGG + Intergenic
980716427 4:136636125-136636147 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
980717004 4:136639941-136639963 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
980734432 4:136867087-136867109 CCGAGGGTGGAGCCTTCACCAGG - Intergenic
981423736 4:144580754-144580776 CCCAGGGTGGAACCCTCGGCAGG - Intergenic
981597717 4:146446062-146446084 TTGAGGGTGGAGCTCTCGCCAGG + Intronic
982004331 4:151049673-151049695 CTGGGGGTGGAGCCCTAGCCAGG + Intergenic
982504105 4:156196642-156196664 CCAAGGGTGGAGCTGTCGCCAGG - Intergenic
982560783 4:156926410-156926432 TAGAGAGTGGAGCCCTTGCCAGG - Intronic
983146019 4:164215536-164215558 CCAGGGGTGGAGCCCTAGCCAGG + Intronic
983717612 4:170804941-170804963 CTGAGGGTGGAGCCCTCGCCAGG - Intergenic
984081183 4:175252176-175252198 CCGGGGGTGGAGCACTAGCCAGG - Intergenic
984289935 4:177782079-177782101 CCAAGGGTGAAGCCCTAGCCAGG + Intronic
984790159 4:183607736-183607758 CCAAGGGTGGAGCTCTCGCCAGG + Intergenic
985271182 4:188196638-188196660 CTGAGGGTGGACCCCTAGCCAGG - Intergenic
985659185 5:1147412-1147434 CCGGGTGTGGGACCCTCGGCGGG - Intergenic
985839027 5:2291667-2291689 CCGAGTGTGGACGCCGGGCCGGG + Intergenic
986160023 5:5219087-5219109 CTGAGTGTGGAGCCCTCTCCAGG + Intronic
986165338 5:5267806-5267828 CCGAGAGTGGAGCCCTCACCAGG + Intronic
986364817 5:7019639-7019661 TAGAGGGTGGAGCCCTAGCCAGG + Intergenic
986365386 5:7023389-7023411 CTGAGGGTGGAGCCCTAGCCAGG + Intergenic
987005643 5:13706906-13706928 CTGAGGGTGGAGCCTTCGCCAGG - Intronic
987524521 5:19030413-19030435 CCGAAGGTGGAGCCCTCGCTAGG + Intergenic
988205272 5:28126139-28126161 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
988225193 5:28404430-28404452 CCGAGTCTGGAGCCGTGGCAGGG - Intergenic
989317683 5:40102080-40102102 CCAAGGGTGGAGCCCTTCCCAGG - Intergenic
989491382 5:42059935-42059957 CCAAGGGTGGAGCCCTCTCCAGG - Intergenic
989498540 5:42138349-42138371 CCAAGGGTGGAGCCCTTGCCAGG + Intergenic
990585607 5:57208095-57208117 CCGGGGATGGAGCCCTCGCGAGG + Intronic
990638060 5:57751082-57751104 CCGGGGGTGGAGCCCTCACCAGG + Intergenic
990792423 5:59496429-59496451 CTGGGGGTGGAGCCCTCGCCAGG + Intronic
992530284 5:77645848-77645870 CCGAGGGAGGGGCCCTTGCCTGG + Intergenic
992904562 5:81333812-81333834 CCGAGGGTGGAGCCCTCACCAGG - Intronic
993143836 5:84069723-84069745 CCGAGGGTGGAACGCTCGCCAGG - Intronic
993188037 5:84645608-84645630 CCGAGGGTGGAGCCCTCGCCAGG - Intergenic
993280470 5:85919645-85919667 CCCAGGGTGGAGCCCTTGCCAGG + Intergenic
993416461 5:87639267-87639289 CCAGGGGTGGAGCCCTCGCCAGG + Intergenic
994448715 5:99912000-99912022 CTGAGGGTGGAGCCCTCACCAGG + Intergenic
996566111 5:124881040-124881062 CTGGGGGTGGAGCCCTCGCCAGG + Intergenic
996890391 5:128411750-128411772 TTGAGGGTGGAGCCCTCGCCAGG + Intronic
997431193 5:133842283-133842305 CCCGGTGTGCAGCCCTCTCCTGG + Intergenic
999537057 5:152529005-152529027 CTGAGGGTGGAGCCCTTACCAGG + Intergenic
1000516513 5:162241604-162241626 GCAAAGGTGGAGCCCTCGCCAGG + Intergenic
1000532764 5:162444427-162444449 CAGGGGGTGGAGCCCTCACCAGG - Intergenic
1000541770 5:162549878-162549900 CATGGTGTGGAGCCCTAGCCAGG - Intergenic
1000658952 5:163915718-163915740 CTGAGGGTGGAGCCCTCACCAGG + Intergenic
1001761606 5:174212300-174212322 CTCAGTGTGGAGCACTGGCCAGG - Intronic
1002465659 5:179407206-179407228 CTGAGTGTGGAGCTGTGGCCAGG - Intergenic
1002475775 5:179464902-179464924 CTGAGGGTGGAAGCCTCGCCAGG + Intergenic
1002477065 5:179473031-179473053 CTGGGGGTGGAGCCCTAGCCAGG + Intergenic
1002962162 6:1925752-1925774 CTGGGGGTGGAGCCCTCACCAGG - Intronic
1003499843 6:6695161-6695183 CCGGGGGTGGAGCCCTAGCCAGG + Intergenic
1003761873 6:9188001-9188023 CTGTGTGTGGAGCACCCGCCTGG + Intergenic
1003809969 6:9768330-9768352 CTGGGGGTGGAGCCCTAGCCGGG + Intronic
1004495187 6:16156282-16156304 TTGAGGGTGGAGCCCTCACCAGG + Intergenic
1004746127 6:18510900-18510922 CCGAGGGTGGAGCCCTCACCAGG - Intergenic
1005029234 6:21493707-21493729 CCGAGGGTGGAGACCTAGCCAGG - Intergenic
1005461133 6:26071286-26071308 CTGGGGGTGGAGCCCTAGCCGGG - Intergenic
1005711910 6:28511454-28511476 CCGAGGGTGGAGCCCTAGTTAGG - Intronic
1006730950 6:36235825-36235847 CTGAGGGTGAAGCCCTCACCAGG - Intergenic
1006802780 6:36769924-36769946 AAGAGTGTGGAGTCCTCACCTGG - Intronic
1007307509 6:40918541-40918563 CCAGGGGTGGAGCCCTCGCCAGG - Intergenic
1007854847 6:44845504-44845526 CCTAGGGTGGAGCCCTCACCAGG - Intronic
1009468365 6:64001907-64001929 CAAAGGGTGGAGCCCTTGCCAGG - Intronic
1010014290 6:71086483-71086505 CCGAGGGTGGAGCCCTCGCCAGG - Intergenic
1010503854 6:76632428-76632450 CCGAGGGTGGAGCCCTTGCCAGG + Intergenic
1010504059 6:76634151-76634173 CCCGGGGTGGAGCCCTTGCCAGG + Intergenic
1010532664 6:76988449-76988471 CTGAGGGTGGAGCCCTCACCAGG - Intergenic
1010533223 6:76992158-76992180 CCAAGGGTGGAGCCCTTGCCAGG - Intergenic
1011873587 6:91927245-91927267 CCAGGGGTGGAGCCCTAGCCAGG + Intergenic
1012330412 6:97978871-97978893 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
1012440132 6:99254853-99254875 CTGAGGGTGGAGCCCTAGCCAGG - Intergenic
1012606741 6:101167595-101167617 CTGGGGGTGGAGCCCTAGCCAGG - Intergenic
1012724895 6:102798723-102798745 CCGAGGGTGGAGCCCTCTCCAGG - Intergenic
1012733270 6:102907996-102908018 CCGAGGGTGGAGCCCTCACCAGG + Intergenic
1012769092 6:103405565-103405587 TTGAGGGTGGAGCCCTCTCCGGG + Intergenic
1013112941 6:107078867-107078889 CTGAGGGTGGAGCCCTAGCCAGG - Intronic
1013459098 6:110358264-110358286 CCGAGTGTAGCGCCATGGCCCGG - Exonic
1014252262 6:119127151-119127173 TCGAGGGTGGGGCCCTTGCCGGG + Intronic
1014323731 6:119966011-119966033 CCGGGGATGGAGCCCTCACCAGG - Intergenic
1015168382 6:130224365-130224387 CTGAGGGTGGAGCCCTAGCCAGG + Intronic
1015729543 6:136334375-136334397 CCAGGGGTGGAGACCTCGCCAGG - Intergenic
1016191225 6:141267537-141267559 CCTAGGGTGGAGCCCTGGCCTGG - Intergenic
1016557310 6:145353135-145353157 CTGAGGGTGGAACCCTTGCCTGG + Intergenic
1018257935 6:161941098-161941120 CCAAGAGTGGAGCCCTAGGCAGG - Intronic
1018620372 6:165724956-165724978 CGGAGGGTGGAGCCTTTGCCAGG - Intronic
1018794478 6:167175152-167175174 CCGGGGGTGGAGCCCTAGCCAGG + Intronic
1018821842 6:167379915-167379937 CTGGGGGTGGAGCCCTAGCCAGG - Intronic
1018842967 6:167531839-167531861 CCGAGGGTGGAGCTCTAGCCAGG - Intergenic
1018869111 6:167768091-167768113 TGGAGTGTGCAGCCCTCGGCAGG - Intergenic
1019618274 7:1977049-1977071 CCGACAGTGGATCCCACGCCGGG + Intronic
1020389934 7:7646959-7646981 TTAAGGGTGGAGCCCTCGCCAGG + Intronic
1021009338 7:15442663-15442685 CCGGGGGTGGAGCCCTCACCAGG - Intronic
1022372297 7:29783304-29783326 CCGATGGTGGAGTCCTCGCTAGG - Intergenic
1022992701 7:35724580-35724602 CTGAGGGTGGAGCCCTCGCCAGG - Intergenic
1023500550 7:40844696-40844718 TTGAGGGTGGGGCCCTCGCCAGG + Intronic
1024440195 7:49408062-49408084 CTGAGGGTAGAGCCCTCACCAGG - Intergenic
1024643929 7:51355759-51355781 CCGGGGGTGGAGCCCTAGCCAGG + Intergenic
1024841418 7:53591387-53591409 CTGAGTGTGAAGCCATAGCCTGG + Intergenic
1026313864 7:69211352-69211374 CCAAGGGTGGAGTCCTTGCCAGG - Intergenic
1026557845 7:71423215-71423237 CCGAGGGTGGAGCCCTTGCCAGG + Intronic
1027706092 7:81535578-81535600 TTGAGGGTGGAGCCCTCACCAGG - Intergenic
1027931852 7:84546840-84546862 TCGAGGGTGGAGCTCTAGCCAGG + Intergenic
1029611680 7:101629922-101629944 CCAAGGGTGGAGCCCTTGCCAGG + Intergenic
1030101738 7:105952873-105952895 CCCACTGTGGAGCCCTAGCCAGG - Intronic
1030270008 7:107660885-107660907 CCGGGAGTGGAGCCCGGGCCGGG - Intronic
1030356736 7:108551798-108551820 CTGAGAGTGGAGCCCAGGCCAGG + Intronic
1031179396 7:118394844-118394866 CCGGGTGTGGAGCCCTAGCCAGG + Intergenic
1031681428 7:124680290-124680312 CCAAGGATAGAGCCCTCGCCAGG - Intergenic
1031765580 7:125773046-125773068 CCGGGGGTGGAGCCTTCACCAGG - Intergenic
1032316386 7:130842355-130842377 CCAAGGGGGGAGCCCTCACCAGG + Intergenic
1032673386 7:134106478-134106500 CTGAGGGTGGAGCCCTAGCCAGG + Intergenic
1033564704 7:142567288-142567310 CCGAGGGTGGAGCCCTCACCAGG - Intergenic
1033635777 7:143210075-143210097 CCGAGGGTGGAGCCCTTGTCAGG + Intergenic
1033857225 7:145578156-145578178 TTGAGGGTGGAGCCCTTGCCAGG + Intergenic
1033896220 7:146073950-146073972 CCTAGGGTGCAGCCCTCGCCAGG - Intergenic
1034119139 7:148611207-148611229 TTGAGGGTGGAGCCCTCACCAGG - Intronic
1034441277 7:151087124-151087146 CGGCCTGTGGAGCCCTCGGCCGG - Intronic
1034931226 7:155165661-155165683 CTGAAGGTGGAGCCCTCACCAGG - Intergenic
1034999689 7:155603020-155603042 CCGAGTGTGGAGCACCAGCGTGG - Intergenic
1035420136 7:158722772-158722794 CTGAGTGGGGAGCACTGGCCTGG - Intergenic
1035771716 8:2152972-2152994 CTCAGTGTGGAGCCCTTGGCTGG + Intronic
1036375274 8:8194417-8194439 CCTGGGGTGGAGCCCTAGCCAGG - Intergenic
1036854265 8:12228731-12228753 CCTGGGGTGGAGCCCTAGCCAGG + Intergenic
1036875626 8:12471231-12471253 CCTGGGGTGGAGCCCTAGCCAGG + Intergenic
1037175837 8:15945116-15945138 CCAAGGGTGGAGCTCTCGCCAGG - Intergenic
1037226721 8:16601901-16601923 CCGAAGGTGGAGCCTTCACCAGG - Intergenic
1038862314 8:31401252-31401274 CCAGGGGTGGAGCCCTAGCCAGG - Intergenic
1038931922 8:32202946-32202968 TTGAGGGTGGAACCCTCGCCAGG + Intronic
1039446569 8:37637741-37637763 CCGGGTCTGGAGCCCAGGCCAGG - Intergenic
1041586201 8:59523158-59523180 CCAGGGGTGGAGCCCTCCCCAGG - Intergenic
1042159265 8:65875437-65875459 CTGAGCATGGAGCCTTCGCCAGG + Intergenic
1043599752 8:81923274-81923296 CTGAGAGTGGAGCCCTCACCAGG - Intergenic
1043605354 8:81992059-81992081 CCGGGGGTGGAACCCTCGCCAGG + Intergenic
1044206146 8:89494017-89494039 CCAAGGGTGGAGCCCTTGCCAGG - Intergenic
1044448231 8:92302773-92302795 CCAAGAGTGGAGCCCTCTCCAGG + Intergenic
1044765741 8:95572281-95572303 CCGAGGGTGGAGCCCTCACCAGG - Intergenic
1045717649 8:105067223-105067245 CCGAGGGTGGAGCCTTAGCCAGG + Intronic
1045938181 8:107706837-107706859 CCAAGGGTGGAACCCTCACCAGG + Intergenic
1046260829 8:111765690-111765712 CCCAGGGTGGAGCCCTCGCCAGG - Intergenic
1046439137 8:114236223-114236245 CTGAGGGTGGAGCCCTCGCCAGG - Intergenic
1047751484 8:127884088-127884110 CTGAGTGTGGAGCCAGCACCTGG + Intergenic
1047883100 8:129218274-129218296 CCGAGGGTGGAGCCCTCGCTAGG - Intergenic
1048623444 8:136159450-136159472 TTGAGGGTGGAGCCCTTGCCAGG + Intergenic
1048800355 8:138188952-138188974 CTGAGGGTGGGGCCCTTGCCAGG - Intronic
1049194559 8:141308208-141308230 CCGAGGGAGCAGCCCCCGCCCGG - Intronic
1050944638 9:11501184-11501206 CCGGGGGTGGAGCCCTAGCCAGG + Intergenic
1051103639 9:13551279-13551301 CCAGGGGTGGAGCCCTAGCCAGG + Intergenic
1052370071 9:27654776-27654798 CCAGGGGTGCAGCCCTCGCCGGG - Intergenic
1052438754 9:28465545-28465567 TTGAGGGTGGAGCCCTTGCCAGG + Intronic
1052566585 9:30160840-30160862 CAGGGGGTGGAGCCCTAGCCAGG + Intergenic
1053525451 9:38825883-38825905 CTGAGGGTGGAGCCCTAGCCAGG - Intergenic
1054197680 9:62050310-62050332 CTGAGGGTGGAGCCCTAGCCAGG - Intergenic
1054640673 9:67538062-67538084 CTGAGGGTGGAGCCCTAGCCAGG + Intergenic
1054912408 9:70466295-70466317 CCGAGGGTGGCTCCCTCGCCAGG + Intergenic
1055054443 9:72010878-72010900 CTGGGGGTGGAGCCCTCACCAGG + Intergenic
1056327289 9:85490587-85490609 CCAAGGGTGGAACCCTCGCCAGG - Intergenic
1057422313 9:94922190-94922212 CCCAGTGTGGAAGCCTCACCAGG - Intronic
1057852461 9:98576033-98576055 CTAAGTGAGGGGCCCTCGCCCGG + Intronic
1058172958 9:101705057-101705079 CCAAGGGTGGAACCCTTGCCAGG - Intronic
1058206957 9:102119942-102119964 CTTGGGGTGGAGCCCTCGCCAGG + Intergenic
1058236663 9:102498453-102498475 CAGAGGGTGGAACCCTTGCCAGG + Intergenic
1058321374 9:103636036-103636058 TGGAGGGTGGAGCCCTCACCAGG - Intergenic
1059494681 9:114699824-114699846 TTGAGGGTGGAGCCCTCACCAGG - Intergenic
1061163467 9:128909426-128909448 CTGAGTGTGGAGTCCTCACCTGG + Intronic
1062474780 9:136721601-136721623 CCCAGTGTCGACCCCACGCCAGG - Intronic
1062607637 9:137355247-137355269 CAGACTGTGGTGCCCTCCCCGGG - Intronic
1203516835 Un_GL000213v1:9265-9287 CTGAGTGAGGCGCCCTCTCCTGG + Intergenic
1185853325 X:3509276-3509298 CTGAGGGTGGAGACCTCACCAGG - Intergenic
1186047451 X:5551968-5551990 CCGAGGGTGGAGCCCTCGCCAGG - Intergenic
1187097222 X:16161590-16161612 CTGAGGGTGGAGCCCTTACCAGG - Intergenic
1187138454 X:16570794-16570816 CTGGGGGTGGAGCCCTCACCAGG - Intergenic
1187885223 X:23883154-23883176 CCAGGGGTGGAGCCCTAGCCAGG - Intronic
1188438058 X:30185405-30185427 TTGAGGGTGGAACCCTCGCCAGG - Intergenic
1189642350 X:43086266-43086288 CCAAGGGTGGAGCCCTTGCCAGG + Intergenic
1189959134 X:46307948-46307970 CCGGGGGTGGAGCCCTAGCTAGG + Intergenic
1190535280 X:51420466-51420488 CTGAGGGTGGAGCCCTCACCAGG + Intergenic
1190631355 X:52389786-52389808 CCGAGGATGGAGCCTTCACCAGG + Intergenic
1191205872 X:57833735-57833757 CCAAGGGTGGAGCCCTTTCCGGG - Intergenic
1191939519 X:66463125-66463147 CCCAGGGTGGAGCCCTCGCCAGG - Intergenic
1192087745 X:68117709-68117731 CAGAGTGTGGAGACCTGTCCTGG + Intronic
1192098599 X:68239483-68239505 CCAGGGGTGGAGCCCTAGCCAGG + Intronic
1193183685 X:78487229-78487251 CGGGGGGTGGAGCCCTAGCCAGG + Intergenic
1193400549 X:81037020-81037042 CCGGGGGTGGAGCCCTAGCCAGG + Intergenic
1193608133 X:83593841-83593863 ATGAGGGTGGAGCCCTAGCCAGG - Intergenic
1194068328 X:89288716-89288738 CTGGGTGTGGAGTCCTAGCCAGG + Intergenic
1194105964 X:89767717-89767739 CTGAGGGTGGAGCCCTTGCAAGG - Intergenic
1194690700 X:96980575-96980597 TTGAAGGTGGAGCCCTCGCCAGG + Intronic
1195705547 X:107735584-107735606 GCCAGTGAGGAGCCGTCGCCTGG - Intronic
1196258947 X:113555122-113555144 CCGAGGGTGGAGCCCTAGCCAGG + Intergenic
1196271363 X:113716023-113716045 CCGAGATTGGAGCCCTCACCAGG - Intergenic
1196376578 X:115039808-115039830 TCCAGGGTGGAGCCCTTGCCAGG - Intergenic
1196998150 X:121407170-121407192 CCGAGGGTGGAGCCCTTGCCAGG - Intergenic
1197459521 X:126723552-126723574 CCAGAGGTGGAGCCCTCGCCAGG - Intergenic
1197774685 X:130111208-130111230 CAGAGTGGGGAGCGCCCGCCCGG - Intergenic
1198167628 X:134072744-134072766 CCGAGGGTGGAGCCCTCACCAGG + Intergenic
1198386679 X:136135353-136135375 CTGGGGGTGGAGCCCTAGCCAGG + Intergenic
1199069721 X:143462291-143462313 CCGAGAGTGGAGCCTTCACCAGG - Intergenic
1199143382 X:144336302-144336324 CCGAGGGTGGAGCCCTAGCCGGG + Intergenic
1200457921 Y:3415576-3415598 CTGAGGGTGGAGCCCTTGCAAGG - Intergenic
1200722470 Y:6622885-6622907 CTGGGTGTGGAGTCCTAGCCAGG + Intergenic
1201340398 Y:12926647-12926669 CTGAGGGTGGAGCCCTCACCAGG + Intergenic
1201508776 Y:14734415-14734437 TTGAGGGTGGAGCCCTCTCCAGG + Intronic
1201695398 Y:16818608-16818630 CAGAGGGTGAAGCCCTCTCCAGG + Intergenic