ID: 973242790

View in Genome Browser
Species Human (GRCh38)
Location 4:47975276-47975298
Sequence ATGTTGCCCCAGCACACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973242788_973242790 30 Left 973242788 4:47975223-47975245 CCAGCTGTAATTCTCATGAAAAA 0: 1
1: 1
2: 27
3: 57
4: 308
Right 973242790 4:47975276-47975298 ATGTTGCCCCAGCACACACAGGG 0: 1
1: 0
2: 0
3: 21
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973242790 Original CRISPR ATGTTGCCCCAGCACACACA GGG Intronic
901513777 1:9731624-9731646 ATTATTCCCCATCACACACAAGG - Intronic
901944948 1:12694144-12694166 ATGTTACCCCAGAACCCAAAGGG - Intergenic
902363964 1:15958829-15958851 ATCATGCCCCAGCACACAGGAGG + Intronic
904642757 1:31942804-31942826 ATGTGGGCCCACCACACACAGGG + Intronic
905360793 1:37418895-37418917 TTGTTTCCCCAGCACTCATAGGG - Intergenic
905520277 1:38593744-38593766 ATCTTGCCCCAGCAGACTCGGGG - Intergenic
906320181 1:44810794-44810816 CTCTTCCCACAGCACACACAGGG - Intronic
906470273 1:46124025-46124047 ATGTGGCCCCAGTAAACACTGGG + Intronic
912580803 1:110719300-110719322 CTGTGGCCCCAGCCCACACTGGG + Intergenic
913325408 1:117623878-117623900 TTGTTCCGCCAGCACACGCAAGG - Exonic
914237616 1:145826464-145826486 ATGTTGGACGAGGACACACAGGG - Exonic
918550733 1:185739290-185739312 ATGTTGCACCAGCAAAGACATGG - Intronic
920274219 1:204792009-204792031 CTGTTTCCCCAGCACCCTCAGGG - Intergenic
1063627316 10:7702189-7702211 ATGTTTCTCCAGCAGACACACGG + Intergenic
1069074171 10:64020880-64020902 AGGTTCTCCCAGCACACAGATGG - Intergenic
1076122681 10:127948896-127948918 ATGTTGCCCATGCACACTGAGGG - Intronic
1076337677 10:129719352-129719374 AGGTTGCCCCAGCGCGCACCAGG - Intronic
1076571644 10:131437242-131437264 ATGGGGCCCCAGCAGGCACACGG - Intergenic
1076768497 10:132650699-132650721 AAGGTGGCCCAGCACGCACAGGG + Intronic
1076859396 10:133133532-133133554 ACGCTGCCCCTGCAGACACAGGG - Intergenic
1076886184 10:133263665-133263687 GTGAGGCCCCAGCACACACCAGG - Intronic
1082741659 11:56917797-56917819 ATATTGCCCCACTACAGACAGGG - Intergenic
1084501370 11:69537528-69537550 ATGTGACTCCAGCACACACACGG - Intergenic
1087058960 11:93959951-93959973 AACTTGCCCAAGCTCACACATGG - Intergenic
1089134875 11:116240872-116240894 ATGTGGCTCCTGCACACACTTGG - Intergenic
1089283741 11:117392470-117392492 AGGAGGCCCCCGCACACACAGGG - Intronic
1089407664 11:118211882-118211904 ATGATTCCCCAGCACATACATGG + Intronic
1091460413 12:640088-640110 ATGTATCCCCAGTTCACACACGG + Intronic
1094740076 12:33279073-33279095 ATGTTGACCCAGCAGACATGTGG + Intergenic
1097457637 12:59819713-59819735 ATGGCCACCCAGCACACACATGG + Intergenic
1097744332 12:63284813-63284835 ATGTTGTGCCATCAAACACAAGG + Intergenic
1099011681 12:77298748-77298770 ATGTGGCCTCAGCACAAACTGGG - Intergenic
1103337462 12:120200676-120200698 ATGTTGCCCCAGCGCAAATAGGG - Intronic
1104288496 12:127447131-127447153 TTGTTCCCCCAGGAAACACAGGG + Intergenic
1106806559 13:33314000-33314022 ATGTATCTCCATCACACACATGG + Intronic
1107455471 13:40550625-40550647 ATGTTGTCCCAGCACAGTTATGG - Intergenic
1112256898 13:97842277-97842299 CTGCTGCCCCAGCAAACCCACGG - Intergenic
1113602140 13:111577466-111577488 ATGCTGCCCCGGCACACATGTGG + Intergenic
1113633334 13:111902911-111902933 CTGTTGCTCCAGCACTTACACGG + Intergenic
1113800479 13:113083727-113083749 CTTTTCCCTCAGCACACACACGG - Intronic
1113801518 13:113088948-113088970 CTGATGGCCCAGCACACACGTGG + Intronic
1113815816 13:113170252-113170274 TTCTTGCCCCAGCACTCAAATGG - Intronic
1114195093 14:20469822-20469844 TTGTTCCCCTAACACACACACGG - Intronic
1114688750 14:24560556-24560578 ATGTTGCCTAAGCACAGCCAGGG + Intergenic
1117633785 14:57721861-57721883 CTGTTGCCTCAGGAGACACAGGG - Intronic
1118280540 14:64424350-64424372 TTGTTCCTCCAGCTCACACATGG + Intronic
1119996119 14:79255469-79255491 ATCTTGCCCAAGGTCACACAGGG - Intronic
1120721104 14:87890577-87890599 ATGTTTCCCCACCACTTACAAGG + Intronic
1122137749 14:99644721-99644743 GTGTTGCCCCAGGACTCTCAGGG - Intergenic
1123578916 15:21698710-21698732 ATGTTGCACCAGAACCCACAAGG + Intergenic
1123615543 15:22141192-22141214 ATGTTGCACCAGAACCCACAAGG + Intergenic
1126468548 15:48983033-48983055 AGGCTGCCCCATCTCACACATGG - Intergenic
1126804402 15:52331753-52331775 ATGCTGCAGCAGCACACACTGGG + Intronic
1128161546 15:65425976-65425998 ATGTCCCCCCACCCCACACACGG - Intergenic
1130327259 15:82890965-82890987 ATGTTCCCCCATCAAACACGAGG + Intronic
1130561253 15:84961042-84961064 ATCTTGCCCGAGGACACACAGGG - Intergenic
1202987786 15_KI270727v1_random:432955-432977 ATGTTGCACCAGAACCCACAAGG + Intergenic
1132565366 16:620002-620024 ATGTTGCTCCAGTTCTCACAGGG - Intronic
1135737453 16:24943504-24943526 ATGTTTCACCAGCAAACATATGG + Intronic
1136009964 16:27357086-27357108 CTCTTGGCCCAGCACACACTAGG + Intronic
1136220635 16:28825510-28825532 CTGTGGGCCCGGCACACACAAGG + Intronic
1137505328 16:49049465-49049487 ATGCTGCCACAGCAAACACCTGG + Intergenic
1137571442 16:49568822-49568844 CTCTTGTCCCAGCACACACGGGG + Intronic
1137769258 16:51003159-51003181 AGGTCCCCCCACCACACACACGG - Intergenic
1141085482 16:81092248-81092270 ACTATCCCCCAGCACACACACGG + Intronic
1141282998 16:82645634-82645656 ATACTCACCCAGCACACACAGGG + Intronic
1143205170 17:5136159-5136181 ATGTGGCTCCAGGACACAGAGGG - Intronic
1145266577 17:21382665-21382687 ATGTTGCCTCAGAAAAGACAGGG + Intronic
1146403491 17:32518714-32518736 ATGTTGCTCCAGGACAAAGAGGG + Intronic
1147045823 17:37751430-37751452 CGGTTGGCCCAGCACACAGAAGG + Intergenic
1148447622 17:47747732-47747754 ATGTTGCCCCACCACAGTCCAGG + Intergenic
1151344873 17:73495301-73495323 CTGTTGCCCCAGGACACAGGTGG + Intronic
1151441078 17:74129505-74129527 ATGTTGCCTCAGCATACATGGGG - Intergenic
1152044005 17:77924060-77924082 ATGTTGCCCGAGGGCAAACAGGG - Intergenic
1152554831 17:81047867-81047889 ACATGGCCGCAGCACACACACGG + Intronic
1154148190 18:11884096-11884118 TGGTGGCCCCAGCACACACTTGG - Exonic
1155037895 18:22040709-22040731 ATGTGGCCCAAGCCAACACAGGG - Intergenic
1155457537 18:26034699-26034721 CAGTTTTCCCAGCACACACAGGG + Intronic
1156261651 18:35450021-35450043 ATGGTGCCCAATCACACACAAGG + Intronic
1158667794 18:59448565-59448587 ACGGTTCCCCAGCACACTCAGGG + Intronic
1160403990 18:78631953-78631975 GTGTCTCCCCAGCACACGCATGG + Intergenic
1160523297 18:79521179-79521201 CTGATGCCCCCACACACACATGG - Intronic
1160915320 19:1493554-1493576 GTGTTGCCCAAGGTCACACAGGG - Intronic
1162417097 19:10544503-10544525 ATCTTGCCCAAGGTCACACAGGG - Intronic
1163507858 19:17719044-17719066 CTCTTGCCCCACCACCCACAAGG + Intergenic
1164233344 19:23310649-23310671 ATGTGGGCCCAGCCCACAGAAGG + Intronic
1164674733 19:30093612-30093634 ATGGTGCCCTAGCTCACACCTGG - Intergenic
1168191289 19:54740447-54740469 CTGTGACCCCCGCACACACAGGG + Intronic
1168193550 19:54757051-54757073 CTGTGACCCCAGCACACACAGGG + Intronic
1168195614 19:54771789-54771811 CTGTGACCCCAGCACACGCAGGG + Intronic
1168199553 19:54804973-54804995 CTGTGACCCCAGCACACGCAGGG + Exonic
925278830 2:2669146-2669168 GTCAGGCCCCAGCACACACATGG + Intergenic
926130550 2:10301352-10301374 ATTTCTCCCAAGCACACACAGGG - Intergenic
927671596 2:25073179-25073201 GTGTTGTCCCAGCACACACTCGG + Intronic
937303026 2:120854880-120854902 CTGTTGGCCCAGAACACACTTGG + Intronic
938551420 2:132385890-132385912 ACAGTGCCCCAGCACACACTAGG - Intergenic
939604258 2:144234295-144234317 AGGTTGCAGCAGCACACACTTGG - Intronic
941453546 2:165689476-165689498 ACGCTGTCCCAGCACACACAAGG + Intergenic
948246053 2:236487022-236487044 ATATTCCATCAGCACACACATGG - Intronic
948425687 2:237885538-237885560 CTATTCCACCAGCACACACAGGG - Intronic
948764713 2:240213504-240213526 ATGTTTCCCCAACACATGCAGGG + Intergenic
1169003138 20:2182825-2182847 AGGAGGCCCCAGCTCACACAGGG + Intergenic
1169344342 20:4818466-4818488 ATCTGGCCCCAGCACACATCGGG - Intronic
1171231014 20:23485205-23485227 ATGATGTCCCAGCCCAAACAGGG + Intergenic
1172188803 20:33049200-33049222 ATGTTCCCACAGCACACTTATGG + Intergenic
1173414244 20:42841458-42841480 ATGTTGCCCCAGATCTCACTAGG - Intronic
1173670471 20:44795281-44795303 AAGTTGCCCAAGATCACACAGGG - Intronic
1173968169 20:47129693-47129715 ATAGTGGCCCAGCACACAGAGGG + Intronic
1174140099 20:48406656-48406678 ATGTTGTCTAAACACACACAAGG - Intergenic
1174845396 20:53938392-53938414 ACTTTGCCCAAGAACACACATGG - Intronic
1175258019 20:57658494-57658516 ATCTCTACCCAGCACACACACGG - Intronic
1180106950 21:45625238-45625260 ATGTTGTCCCATGTCACACAAGG + Intergenic
1180941492 22:19662184-19662206 CTGTTGCCCCAGCTCACTCAGGG - Intergenic
1181749978 22:24982613-24982635 AAGTTACCCCAGCACCCACAGGG - Intronic
1183246387 22:36696899-36696921 AACTTGCCCCAGATCACACAAGG + Intronic
1183696805 22:39428226-39428248 CTGGTGCCACAGGACACACACGG - Intronic
950458092 3:13104579-13104601 ATGTGGCCCCAGCGTGCACAGGG - Intergenic
955888510 3:63625899-63625921 AATGTGCCCCAGTACACACAAGG + Intergenic
957411274 3:79844012-79844034 ATGTTACACAATCACACACAAGG + Intergenic
957782303 3:84835077-84835099 ATCTTGCCACAGCACACTCTGGG - Intergenic
959473641 3:106783629-106783651 ATGTTGCCCGGGAACCCACATGG + Intergenic
961009751 3:123427654-123427676 AACTTGCCCAAGCTCACACAAGG - Intronic
961170848 3:124796766-124796788 AAGCTGTCCCAGCAGACACACGG - Exonic
961810095 3:129517138-129517160 AGACTGCCCCTGCACACACACGG + Intronic
962741782 3:138367337-138367359 AACTTGCCCCAGGTCACACAGGG + Intronic
963034201 3:141011121-141011143 ATGGTCCCACAGAACACACACGG - Intergenic
966959661 3:184922265-184922287 GTGTTGCCTGAGCACAGACAAGG - Intronic
967656152 3:192052394-192052416 ATGTTGCCAGAGCAGACATAAGG - Intergenic
968361071 3:198147295-198147317 CTGTTTCCCCAGCAGAGACAAGG + Intergenic
968480237 4:830039-830061 ATGGTGCCCCAGGGCACACATGG + Intergenic
968803452 4:2757402-2757424 ATGATGCCCAAGCACACATGGGG + Intergenic
969701759 4:8771466-8771488 ATTTCACCCCAGCACACACAAGG - Intergenic
973070206 4:45849319-45849341 ATGTTGCCCACGCACACTGAGGG - Intergenic
973209992 4:47605044-47605066 ATGTTCCCCCAGCTCTCACATGG + Intronic
973242790 4:47975276-47975298 ATGTTGCCCCAGCACACACAGGG + Intronic
975292693 4:72695746-72695768 ATGTTCCCACAGCAGAGACAGGG - Intergenic
983274427 4:165600331-165600353 ATGTTGCTACAGGAGACACATGG - Intergenic
985609138 5:877021-877043 GTGTTGCCCCTGCAGCCACAAGG + Intronic
988679283 5:33469040-33469062 ATGGTGCCCACGCACACAGAGGG - Intronic
993251810 5:85536119-85536141 ATGTTGCCTGAACTCACACATGG - Intergenic
997780471 5:136652670-136652692 TAGTTGCCCCACCAGACACATGG + Intergenic
999567475 5:152880955-152880977 ATGTTCCCACAACACACACTGGG + Intergenic
999869063 5:155730610-155730632 ATGCTTTCCCAGCACACACTTGG + Intergenic
1004088049 6:12471246-12471268 ATGTTTCCCCAGTTCACACCTGG + Intergenic
1004501278 6:16212441-16212463 ATGTTGCCCAAGCAAACTCCTGG + Intergenic
1009468034 6:63997626-63997648 AAGTTGCACATGCACACACAGGG - Intronic
1015464095 6:133528622-133528644 ATGAAGCAGCAGCACACACAGGG - Intronic
1016260220 6:142160330-142160352 ATGTTCCCAATGCACACACAGGG - Intronic
1017378045 6:153793940-153793962 ATGTGGTCCTAACACACACATGG + Intergenic
1017397520 6:154019782-154019804 CTGTTGCCCAGGCACAAACATGG + Intronic
1018194224 6:161340688-161340710 ATGTTGGCCAAGCATACAGATGG + Intergenic
1018381227 6:163260019-163260041 AGGGTGCCCCAGGACACACGAGG + Intronic
1019258938 7:69359-69381 CTGTTTCCCCAGCAGAGACAAGG - Intergenic
1019625777 7:2014970-2014992 CTGTGGACACAGCACACACAAGG + Intronic
1019997791 7:4735835-4735857 ATGTTTCCCCAGCATGCTCAGGG - Intronic
1024905588 7:54375380-54375402 ATGTTGCCCCACCCCAGACTCGG + Intergenic
1026323793 7:69290676-69290698 ATCTTGCCACACCAGACACAAGG - Intergenic
1026807416 7:73436815-73436837 AAGCTACCCCAGCACACAGATGG - Intergenic
1027715415 7:81663298-81663320 ATTTTGGCCCAGCCTACACAAGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1032007711 7:128316998-128317020 ATCTTCCCCCAGGACATACAGGG - Intronic
1033604775 7:142918960-142918982 ATGTGGCCAGAGCTCACACAGGG - Intronic
1034627294 7:152503462-152503484 AGTTTGCACCAGCACACACTAGG + Intergenic
1035079482 7:156204156-156204178 ATCTTGCCCATGGACACACAAGG + Intergenic
1036136834 8:6169785-6169807 GTGTGGTCACAGCACACACATGG + Intergenic
1036236461 8:7043380-7043402 TGGTGGCCCCAGCAGACACAGGG + Intergenic
1039920537 8:41891161-41891183 GTGTTGCCAAAGCAGACACAGGG + Intronic
1041016395 8:53596118-53596140 ACCTTTCCCCAGCACACTCATGG - Intergenic
1041470501 8:58203281-58203303 CTGGTGCCCCAGCTCACAGAAGG + Intronic
1047996710 8:130343418-130343440 ATAATGCACCAACACACACAAGG + Intronic
1048318161 8:133377224-133377246 ATGCTGTCCCAGCACAGATAGGG + Intergenic
1050234941 9:3567834-3567856 ATGGTGACCCAGCACATACAGGG - Intergenic
1056453017 9:86734838-86734860 ATGTTGCCCCAGCAGGAAGAGGG - Intergenic
1058686689 9:107487237-107487259 AAGTGGGGCCAGCACACACAGGG + Intronic
1060765656 9:126293641-126293663 CTGTTGCCCCAGCACCCATGCGG + Intergenic
1061209339 9:129181818-129181840 ATGCTGCCCCAGCAGACACTTGG - Intergenic
1061418879 9:130462602-130462624 ATGTTTCCCCAACACAAAGACGG - Intronic
1061455321 9:130693274-130693296 ATGTTGAGCCAGCACCCACGGGG + Intergenic
1062194025 9:135263450-135263472 GTTCTGCCCCAGCACACACTTGG - Intergenic
1062311715 9:135941636-135941658 ATGATGCCCCAGTACTCCCAAGG + Intronic
1062388509 9:136324789-136324811 AGTCAGCCCCAGCACACACAGGG - Intergenic
1062410820 9:136423382-136423404 ATGTCGCCACAGCACCCACGCGG + Exonic
1062745781 9:138211123-138211145 CTGTTTCCCCAGCAGAGACAAGG + Intergenic
1186238682 X:7542872-7542894 ATGTTGAGCCAGCACTCCCAGGG - Intergenic
1186696847 X:12044067-12044089 ATTTTTCCCCAGCCCAAACAAGG - Intergenic
1186854984 X:13617844-13617866 ATGTTACCCCAGAACCCACCAGG + Exonic
1192952407 X:76031041-76031063 TTGTTGACCAATCACACACATGG + Intergenic
1195933731 X:110105566-110105588 TAGTTGCCACAGAACACACAAGG + Intronic