ID: 973248392

View in Genome Browser
Species Human (GRCh38)
Location 4:48035348-48035370
Sequence CACCAATACCACTATGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973248392 Original CRISPR CACCAATACCACTATGAGCT AGG (reversed) Intronic
902665858 1:17937527-17937549 CACAAATACCACTCTGTTCTAGG - Intergenic
902764902 1:18607547-18607569 CTCCAACAACACTGTGAGCTGGG + Intergenic
903587550 1:24427698-24427720 CACAAACAACACTATGAGATGGG - Intronic
907741050 1:57166143-57166165 CATCAATAGCCCTATGAGGTAGG + Intronic
908246534 1:62231701-62231723 CACCAATACCACCATGCATTGGG + Intergenic
910089632 1:83446911-83446933 CACAAATAATACTATGAGATAGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
914931870 1:151942210-151942232 CACCTACAACACTATGAGTTAGG - Intergenic
916204776 1:162305795-162305817 CTCCAACTCCACTATGACCTAGG - Intronic
918563561 1:185898535-185898557 TACCAAGACACCTATGAGCTAGG - Intronic
919781048 1:201221490-201221512 CACCAGCATCACTCTGAGCTGGG + Exonic
922587898 1:226749548-226749570 CACCAACAACACTGTGATCTTGG - Intergenic
924229627 1:241952674-241952696 GAACAATACTACTATGAGCATGG + Intergenic
924232928 1:241977471-241977493 CACCAATCCCTCTGTGATCTAGG - Intergenic
1063772792 10:9223007-9223029 CACCCACAACACTATGAACTTGG - Intergenic
1070440212 10:76435711-76435733 CACCAACCCCTCTATGAGCATGG - Intronic
1070441359 10:76447580-76447602 CCCCAATACCACTATGAGACAGG - Intronic
1073815832 10:107205539-107205561 CTCCAATAACACTATGAGTATGG - Intergenic
1076772996 10:132677230-132677252 CTCCAAGACCAATGTGAGCTGGG - Intronic
1077405343 11:2380037-2380059 CACCAACACCACCAGGAGGTAGG - Intronic
1078511155 11:11985182-11985204 CACCAAGACCATTATGAGGATGG - Intronic
1080775810 11:35385588-35385610 TACCAATTCCACAATGAGCCAGG + Intronic
1080960630 11:37154663-37154685 TACCAAGACCTCTATGAACTTGG + Intergenic
1083160992 11:60853961-60853983 TCCCAATAACTCTATGAGCTAGG - Intronic
1084632268 11:70361006-70361028 CAGAAATAACACTATAAGCTTGG - Intronic
1085613108 11:77971101-77971123 TATCAAAACCACAATGAGCTGGG - Intronic
1086671263 11:89550504-89550526 CATCAAAACCACAATGAGATAGG - Intergenic
1088602328 11:111492037-111492059 AACCAATTCCACAATGTGCTAGG - Intronic
1091597231 12:1886328-1886350 CACCAAAATCACTATGTCCTTGG + Exonic
1095796360 12:46223268-46223290 CACCAACAACATTATGAGGTAGG - Intronic
1106599092 13:31172052-31172074 CCACAATACCACAATGAGGTAGG - Intergenic
1110797561 13:79657807-79657829 CACGAATAGCAGTATGACCTGGG - Intergenic
1111930488 13:94508249-94508271 CTTCAATAACACTATGAGTTAGG + Intergenic
1115149269 14:30265338-30265360 CAAGAATACCACTATGAATTTGG + Intergenic
1115186271 14:30691242-30691264 TCCAAATAACACTATGAGCTAGG - Intronic
1117098048 14:52316891-52316913 CTCCCATACCACTCTGAGCAGGG + Intronic
1118896610 14:69950488-69950510 TCCCAAAACCTCTATGAGCTTGG + Intronic
1121914520 14:97824536-97824558 CTCCAGTACCAGTATGAGCAGGG + Intergenic
1122519742 14:102335051-102335073 TTCCAAAACAACTATGAGCTGGG - Intronic
1122646001 14:103194617-103194639 CATCAATACTACAATGAGCATGG + Intergenic
1123998971 15:25738896-25738918 CTCCAAGACCACTGTGACCTTGG - Intronic
1127701718 15:61507698-61507720 AATAAATACCACTTTGAGCTGGG + Intergenic
1129057326 15:72829957-72829979 CACCAACAACACTACCAGCTTGG - Intergenic
1129878954 15:78994685-78994707 CTGGAATGCCACTATGAGCTTGG + Intronic
1131129868 15:89891361-89891383 AATCAAAACCACAATGAGCTGGG + Intronic
1131260911 15:90887246-90887268 CACCACAACCGCTATGTGCTGGG + Exonic
1132896272 16:2230770-2230792 CATCAATGCCACTCAGAGCTCGG + Intronic
1135527790 16:23227323-23227345 TACCAAAACCAGTGTGAGCTGGG - Intergenic
1140751441 16:78028002-78028024 CACCAAAACCACTATTGCCTTGG + Intronic
1151437547 17:74107385-74107407 CACCATCATCACTCTGAGCTGGG + Intergenic
1162247765 19:9416830-9416852 CAAAAATACAACTATTAGCTGGG - Intronic
1166899816 19:46051247-46051269 AAACAATAACACAATGAGCTGGG + Intronic
929626819 2:43417802-43417824 TATCACTACCAGTATGAGCTAGG + Intronic
933858921 2:86444558-86444580 CACCAAAACCAATTTGTGCTTGG + Intronic
937493880 2:122398069-122398091 TAGCAATACCACAATGAGTTGGG + Intergenic
941481581 2:166022365-166022387 CACCAACACCACTAGTAACTAGG + Intronic
942901020 2:181118781-181118803 CAACAAAACCTCTATGAGGTAGG + Intergenic
943324483 2:186481479-186481501 TTCCAATAGCCCTATGAGCTAGG + Intergenic
947120713 2:226811596-226811618 CAACAATTCCACTATTGGCTGGG - Intergenic
1169183655 20:3593416-3593438 CACAAACACCCCTATGAGATAGG + Intronic
1171344147 20:24452881-24452903 CAACAATACCACCCTGGGCTGGG - Intergenic
1173189829 20:40867747-40867769 CACAAATTCTACTATGAGGTGGG - Intergenic
1174442020 20:50563311-50563333 CACCAGCAGCACTGTGAGCTGGG - Intronic
1175279576 20:57794102-57794124 CACGTATGCCACTTTGAGCTGGG + Intergenic
1178337136 21:31753400-31753422 CACTTATACCCCTATGAGCCAGG + Intergenic
1182880577 22:33729619-33729641 CACCAATCCCTCAAAGAGCTGGG + Intronic
1184057182 22:42060433-42060455 CACCAATGCCACCATGAGAGTGG + Intronic
951383575 3:22016326-22016348 CACTAATGCCATTGTGAGCTAGG - Intronic
953853557 3:46484211-46484233 CACCTATGCCACTATGACTTGGG - Intronic
955878728 3:63521720-63521742 GACTAATACCATTATGAGTTAGG - Intronic
957441108 3:80249253-80249275 CTTCAATGCCACTCTGAGCTTGG - Intergenic
957455533 3:80438643-80438665 CACCAACATCAAAATGAGCTTGG + Intergenic
957642734 3:82878571-82878593 CACAAATAACACTGTGATCTTGG + Intergenic
960290239 3:115875488-115875510 CCCAAATATCACTATGTGCTAGG + Intronic
962040043 3:131697475-131697497 CAACAATTCCATTATGAGTTGGG + Intronic
964130142 3:153277539-153277561 CACCAAAACCAAAATGAGCAGGG - Intergenic
966010875 3:175075092-175075114 TAGCAATAACCCTATGAGCTGGG + Intronic
967886068 3:194334378-194334400 CACCAATAACACTATGAGGTGGG + Intergenic
969572023 4:8014662-8014684 CACCCACCCCACTATGTGCTAGG - Intronic
970127403 4:12830520-12830542 CACCAATACCTCAATTAGCAAGG + Intergenic
973248392 4:48035348-48035370 CACCAATACCACTATGAGCTAGG - Intronic
974447625 4:62006906-62006928 CACCAGTGCCACTATGATTTAGG - Intronic
974736567 4:65941884-65941906 TAACAATACCTCTATGGGCTAGG + Intergenic
976793552 4:88907606-88907628 GCCCAATAGCCCTATGAGCTAGG + Intronic
976807391 4:89063412-89063434 CACCCCTCCCACTATGGGCTTGG + Intronic
977889101 4:102287064-102287086 CTACAATAGCACTATGAACTTGG - Intronic
979853404 4:125601583-125601605 AACCTCTACCACTATTAGCTTGG + Intergenic
985771896 5:1817004-1817026 CACCAATACTGCTAGGAACTTGG - Intergenic
986052832 5:4105741-4105763 CCCCCATACCACTTTGATCTTGG - Intergenic
986419950 5:7569725-7569747 CACCATTTCAACTATGGGCTTGG - Intronic
991579190 5:68136561-68136583 CAACAATACAAAAATGAGCTAGG - Intergenic
995856535 5:116598528-116598550 CACCAATTAGACTAAGAGCTGGG - Intergenic
997801368 5:136865843-136865865 CTCCAATTCCACCATGAGCAAGG - Intergenic
999271488 5:150298681-150298703 CCCCAGTACCACTGTGAGGTGGG + Intronic
999929982 5:156421399-156421421 AACCAATACTAATATGAGATCGG - Intronic
1003982078 6:11399476-11399498 AATCAAAACCACAATGAGCTGGG + Intergenic
1004779897 6:18896656-18896678 CATAAATACCAGTATGACCTAGG + Intergenic
1016281103 6:142419898-142419920 CACCATTACCACAATGAACATGG - Exonic
1021135107 7:16955844-16955866 AACCAATACCTCAATGAGCCTGG - Intergenic
1023582158 7:41694763-41694785 CACTTAAACCTCTATGAGCTTGG + Intronic
1024338408 7:48232919-48232941 CTCCAACAACACTATGAGGTAGG - Intronic
1024698179 7:51878035-51878057 CAGCAATACCACCATGAACAAGG + Intergenic
1027306492 7:76903348-76903370 CACAAATAATACTATGAGATAGG + Intergenic
1030968040 7:116018144-116018166 CCCCAACAGCCCTATGAGCTAGG + Intronic
1031519083 7:122740965-122740987 CAGCAATTCCACTTTGAGATTGG + Intronic
1032554234 7:132814909-132814931 CAGCAACTCCAATATGAGCTAGG + Intronic
1035410906 7:158640370-158640392 CACTAATACAAAAATGAGCTGGG + Exonic
1037744913 8:21635448-21635470 CTGCAATGACACTATGAGCTAGG - Intergenic
1040995241 8:53394434-53394456 CTATAAAACCACTATGAGCTGGG - Intergenic
1041717751 8:60947256-60947278 CACAAAGACCACTCTCAGCTAGG + Intergenic
1042191875 8:66195210-66195232 CAGCAATACCTCTATGAGGTAGG - Intergenic
1042231064 8:66555263-66555285 CACCTCTACCAGTATGATCTTGG + Intergenic
1043676375 8:82960823-82960845 CACCAGCACCAAAATGAGCTGGG - Intergenic
1044009126 8:86970396-86970418 CACCAATTCCCCTTTTAGCTAGG + Intronic
1045142361 8:99300835-99300857 TCCCAATAACACTATGAGGTAGG - Intronic
1045701352 8:104870309-104870331 AACCAAAAACACAATGAGCTTGG + Intronic
1046425876 8:114047982-114048004 TACCAATAACCCTATGAGGTAGG - Intergenic
1050206421 9:3201047-3201069 CATCAAGACAACTATGTGCTGGG - Intergenic
1050686600 9:8177339-8177361 CACCAAAAGCATTATGAGCATGG + Intergenic
1055325370 9:75122738-75122760 CACCAAGAACACTATGAAGTGGG - Intronic
1061626557 9:131843951-131843973 CACCAAATCAACCATGAGCTGGG - Intergenic
1189595503 X:42560808-42560830 CACCAATTTCACTATCAGCTAGG + Intergenic
1191114102 X:56833571-56833593 GGCCAATACCACTATGAGTGGGG + Intergenic
1193933397 X:87583939-87583961 TACCACCACCACTATGTGCTGGG - Intronic
1193948985 X:87775026-87775048 CACAAATACAAATATTAGCTGGG + Intergenic
1197358680 X:125469922-125469944 CACCAAGTCCACTCTGAGTTTGG - Intergenic
1198121005 X:133592421-133592443 TCACAATACCACTATGAGGTAGG - Intronic