ID: 973248531

View in Genome Browser
Species Human (GRCh38)
Location 4:48036978-48037000
Sequence TTAAAACAGAAGTGAAACCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 457}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973248530_973248531 6 Left 973248530 4:48036949-48036971 CCAGGGGCTTTTGCTTTAAAAAA 0: 1
1: 0
2: 1
3: 27
4: 384
Right 973248531 4:48036978-48037000 TTAAAACAGAAGTGAAACCACGG 0: 1
1: 0
2: 2
3: 27
4: 457

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973248531 Original CRISPR TTAAAACAGAAGTGAAACCA CGG Exonic
901182955 1:7354080-7354102 TTAAAAGAGGAATGAAATCATGG - Intronic
902096339 1:13949050-13949072 GTAAAACAGAACTCAAACCCAGG + Intergenic
903706851 1:25292279-25292301 TTAAAACATAAGTCAGATCATGG - Intronic
904876269 1:33656897-33656919 TTAGAAGAGAAGAGAACCCATGG - Intronic
907035774 1:51214942-51214964 TTCAAACAGAAGAAAAACAAAGG - Intergenic
908306082 1:62818285-62818307 TTAAAATAGAAGTCTGACCATGG - Intronic
908886385 1:68794024-68794046 ACAAATGAGAAGTGAAACCAAGG + Intergenic
909318165 1:74249142-74249164 TTTAAAGACAAGTAAAACCAAGG - Intronic
909357963 1:74731115-74731137 TTAAACCAAAAATTAAACCAAGG - Intronic
909686945 1:78359963-78359985 TTAAAAGAAAACTGAAATCAAGG - Intronic
909816127 1:79996043-79996065 GAAAAACAGAAGTTAAGCCATGG + Intergenic
909839931 1:80307624-80307646 TAAAACCAGAATTGAAACCTTGG + Intergenic
910000578 1:82336592-82336614 GGAAAACAGAAGTGAAAATAAGG - Intergenic
910013218 1:82490906-82490928 TTGAAAAAAAAGTGGAACCAGGG + Intergenic
910144744 1:84066708-84066730 AAAAAACAGGACTGAAACCAAGG - Intergenic
910347277 1:86254762-86254784 TAAAAACAGAATGGAAACCAAGG - Intergenic
910541584 1:88364376-88364398 TTAATACAGAAATGAAACACAGG + Intergenic
911304170 1:96212650-96212672 TTAAAACAGCAGTGCAAACCTGG - Intergenic
911382430 1:97131689-97131711 TCAATACAGAGGTGAAATCAAGG + Intronic
912976299 1:114333879-114333901 TTCAAACAGAAGAAAAATCATGG - Intergenic
913038242 1:114996167-114996189 TTAAAACATAAGTCAGATCATGG - Intergenic
913529652 1:119724627-119724649 TAATAGCTGAAGTGAAACCAGGG - Intronic
914850636 1:151311394-151311416 CTAGAATAGAACTGAAACCATGG - Intronic
914861925 1:151393695-151393717 TAAAAACAGTAGTGCAGCCATGG + Intergenic
915234045 1:154467360-154467382 TTAAATCAGCCGTGTAACCATGG + Exonic
917029361 1:170671996-170672018 TTAAGACAGAAGAGAAAACCTGG + Intronic
917121320 1:171647223-171647245 TTAAAACAATAGTGGAACCCTGG + Intronic
917271454 1:173279412-173279434 TAAAGACAGAATTGAAGCCATGG - Intergenic
918050645 1:180969732-180969754 TGGAAAAGGAAGTGAAACCAAGG + Intergenic
918427032 1:184421100-184421122 TTAAAGCAGAAGTGTAATCTTGG - Intronic
918857793 1:189781061-189781083 CCAGAAAAGAAGTGAAACCATGG - Intergenic
919159371 1:193808266-193808288 AAGAAACAGAAGTGATACCAAGG + Intergenic
920662572 1:207928950-207928972 TTAAAACAGAAATGAAGGCCAGG - Intergenic
920687745 1:208122347-208122369 CAAAAACAGAATTCAAACCAGGG - Intronic
921225075 1:213010739-213010761 TTAATATGGCAGTGAAACCAGGG - Intronic
921245080 1:213229792-213229814 TTAAAACATAAGTTAGAACATGG - Intronic
921624422 1:217362548-217362570 TGAAAACAAAAGTGAAATTAAGG + Intergenic
921895404 1:220394906-220394928 TTAAAACAAAAGTCAAGGCAAGG + Intergenic
922302409 1:224313507-224313529 TTAAAAAAGAAGTGGCAACATGG + Intronic
924643662 1:245857380-245857402 TAAGAACAGAAGTGAGTCCAGGG - Intronic
924826400 1:247543947-247543969 TAAAATTAGAAGTTAAACCAGGG - Intronic
1062838692 10:652797-652819 TTTAAACAGAAATGGCACCAGGG + Intronic
1062949070 10:1483155-1483177 TTAGAAAAAAAGGGAAACCAAGG - Intronic
1063067691 10:2625633-2625655 TTAAAATAGGATTGAAAACACGG + Intergenic
1063680521 10:8183056-8183078 TTGAATGAGAACTGAAACCATGG - Intergenic
1063702259 10:8395848-8395870 TTTAAACAAAAATGAAACCAAGG + Intergenic
1064999697 10:21327402-21327424 TTATAAAAGGAGTGAAACCTGGG - Intergenic
1065178818 10:23104786-23104808 TTAAAAGAGAAGGGAGCCCAGGG - Intronic
1065792332 10:29272407-29272429 TTGAAACATGTGTGAAACCAGGG + Intergenic
1066084141 10:31960420-31960442 TTAGAACAGAGATGAAAGCAAGG - Intergenic
1068172035 10:53406233-53406255 TTAAAACATATGTGAAAATAGGG + Intergenic
1068364540 10:56028974-56028996 TAAAAACAGAAGTGAAAGAGAGG + Intergenic
1070645806 10:78201505-78201527 ATAAAAGACAAGTGAAAGCATGG + Intergenic
1071350734 10:84741008-84741030 TTAAAGTAGAAGTCAAAACAGGG - Intergenic
1071757523 10:88560486-88560508 TTCAAACAGATGTGAAAGCTTGG + Intronic
1072076975 10:91986560-91986582 TTATAAAAGAAGAGAACCCAGGG - Intronic
1072114546 10:92357578-92357600 TTAAAACACAATTGAACTCATGG - Intergenic
1072265817 10:93726864-93726886 AGAAAACAGATGTGAAACAAAGG + Intergenic
1075320110 10:121484805-121484827 CTAAAACACAAGTGAGACCTAGG + Intronic
1075873630 10:125789009-125789031 TAAAGACAGAAGAGAAAACAGGG + Intronic
1076664726 10:132080003-132080025 TAAAAACAGAATTGAAAGCGGGG - Intergenic
1077427281 11:2488699-2488721 TGAAATCAGAAGTGAAAATAGGG - Intronic
1078995279 11:16691484-16691506 ATAAAACAGAAGTGTAAAGAAGG + Intronic
1079576029 11:22003888-22003910 TTAAAGCAGGAATGAAAGCAAGG - Intergenic
1079833459 11:25300857-25300879 TTAATACAAAATTGATACCAAGG + Intergenic
1079838206 11:25362418-25362440 TTTAAACAGAAAGGAAACAATGG + Intergenic
1079963186 11:26949183-26949205 TTAAAAATGAATTGAAACTAAGG + Intergenic
1079963252 11:26949967-26949989 TGAAAACAGAAGTAAAATAAAGG + Intergenic
1080147732 11:29007575-29007597 TAAAATCATAAGTCAAACCATGG - Intergenic
1081470707 11:43367684-43367706 TGATAGCAGAAGTGAAAACAAGG + Intronic
1081494067 11:43588906-43588928 TTAAAAGGGACGTGAAAGCAAGG - Intronic
1082919284 11:58474764-58474786 TAAAATCAGAAATGAAACAAGGG + Intergenic
1083907658 11:65684005-65684027 TGAAAACAGAAGAAAAACAAAGG + Intergenic
1084015079 11:66373812-66373834 CTAAAACTGCAGTGAATCCACGG + Intergenic
1084341346 11:68504147-68504169 TTAAATCAGCAGTAAAACAAAGG + Intronic
1084425255 11:69080873-69080895 TTTCAACAGAAATGAAAGCATGG + Intronic
1084923646 11:72493735-72493757 TTAAAACAGAAGAGAACCAGAGG + Intergenic
1085361503 11:75892092-75892114 TAACAAAACAAGTGAAACCAAGG + Intronic
1086663260 11:89448271-89448293 TTAAAACAGAAGGGCAACTGAGG + Intronic
1087860219 11:103144396-103144418 TTAAAACTGAACTAAAACTATGG + Intronic
1088024605 11:105162722-105162744 AAAAAAAAGAAGTGAAAACAGGG - Intergenic
1088149373 11:106725596-106725618 TCAAAACAAAAATGAAGCCATGG + Intronic
1089312098 11:117565162-117565184 TTAAAACAGAAGAAATACTAAGG - Intronic
1091121128 11:133058530-133058552 ATAAAACAGAAGTGGACACAGGG - Intronic
1091254391 11:134171384-134171406 TGAAAACAGAAGTGGACACATGG - Intronic
1091427228 12:401628-401650 GAAAAACAAAAGTCAAACCAAGG - Exonic
1093208677 12:16281627-16281649 TAAAAATAGAAGAAAAACCATGG + Intergenic
1093514438 12:19969535-19969557 GAAAGACAGAAGTGAAAACACGG - Intergenic
1095789502 12:46148852-46148874 TTACAACAGACTTGTAACCATGG - Intergenic
1096562746 12:52448453-52448475 TGAAAAAGCAAGTGAAACCAGGG - Intronic
1097471512 12:59998828-59998850 TTAAAACAAAAGAAAAACAAAGG + Intergenic
1098030039 12:66243973-66243995 AAAAAACAGAGATGAAACCATGG + Intronic
1098044788 12:66389216-66389238 TTAAAACAAAAATAAAAGCAAGG - Intronic
1098287171 12:68919032-68919054 GTAGAACAGAAGTGAGACCAGGG - Intronic
1098415403 12:70229369-70229391 TTAAAACTTAAGTAAAGCCAGGG - Intergenic
1100045557 12:90376033-90376055 TTAAAATAGAAGTTAAAAAATGG - Intergenic
1100503639 12:95198147-95198169 ATAAAATAATAGTGAAACCATGG + Intronic
1100885385 12:99064333-99064355 GTAAAATAGAAGTGAAGCAATGG + Intronic
1101623450 12:106414629-106414651 TTAAAAATGAGGTGAAGCCATGG - Intronic
1102091726 12:110195706-110195728 TCAAAAGAGAAGTGAGACAAAGG - Intronic
1102252777 12:111398714-111398736 AGAAAACAGAACTGAATCCAAGG + Intergenic
1103059328 12:117846242-117846264 TTAAAACTGAAGTGAAACAATGG - Intronic
1104111189 12:125706266-125706288 TTATAAGAGAAGAGAAACAAAGG + Intergenic
1104356919 12:128095087-128095109 CAAAAACAGAATTGGAACCAAGG - Intergenic
1104395759 12:128431138-128431160 TGAACACAGAAGTGATACGAAGG + Intronic
1105489985 13:20879045-20879067 CTAAAACAGAAGCGAACGCAGGG + Intronic
1107578460 13:41753503-41753525 TTAAAACAGAAGAGAATATATGG - Intronic
1108272524 13:48775532-48775554 TTAAAGTAAAAGTCAAACCATGG - Intergenic
1108317388 13:49250007-49250029 TTAAAACAGAGGTAAAATGAGGG + Intronic
1108354027 13:49614108-49614130 TTAAAAAAGAAGAAAACCCAGGG - Intergenic
1108720139 13:53123322-53123344 TTAAAACAGAAGTAGAAGTAAGG - Intergenic
1110237880 13:73235345-73235367 TAAAAACAAAAATAAAACCATGG - Intergenic
1110943664 13:81385675-81385697 TTAAAAAGGAGGTGAAAACATGG + Intergenic
1111344125 13:86926410-86926432 TTAGAACAGAAATGAAAGGAAGG + Intergenic
1112402942 13:99091500-99091522 GTAAAACAGAAGTGAAAGAGGGG - Intergenic
1112882877 13:104131246-104131268 TTAAAATCTAAGTCAAACCATGG - Intergenic
1113045279 13:106148168-106148190 TGACTACAGAAGTGAAATCAAGG + Intergenic
1113510299 13:110848780-110848802 TTTCAACAGAACTGAAACAAGGG - Intergenic
1115161084 14:30395183-30395205 TCAAACCACAACTGAAACCATGG + Intergenic
1115336584 14:32248594-32248616 TTAGAACAGAGGTGAAGTCAAGG - Intergenic
1115402847 14:32982600-32982622 TTATAACAGAAGTAAGAGCATGG - Intronic
1116003534 14:39268644-39268666 TTAAACCACAAGTCTAACCACGG - Intronic
1116010807 14:39349602-39349624 TAAAAAGAGAAGAGAAACAAGGG - Intronic
1116239118 14:42318662-42318684 TTAAAATTCAAATGAAACCATGG - Intergenic
1117093813 14:52276399-52276421 AAAAAACATAAGTGAAACAAAGG - Exonic
1117239978 14:53821186-53821208 TTAAAACACAAGAAAAAACAGGG + Intergenic
1118116756 14:62786371-62786393 TAAAAAAAGAAGTGAAGGCATGG - Intronic
1118408993 14:65457265-65457287 TTAAAAAAGAAATGCAACCATGG - Intronic
1118786599 14:69050849-69050871 TTAAAACAGAAAAGAAATAAAGG + Intergenic
1119273677 14:73332611-73332633 TTAAAAGGGAATTGAAAGCAAGG - Intronic
1120231012 14:81841428-81841450 TTAAAATAAACGAGAAACCAGGG + Intergenic
1120457344 14:84749009-84749031 TTAGAACAGAAGTCAAGTCATGG + Intergenic
1121165152 14:91789047-91789069 ATAAAACACAAGGGAAATCATGG + Intronic
1121379327 14:93448949-93448971 TGAAAACAGGAGTCAAAGCAAGG - Intronic
1122172142 14:99885638-99885660 TTAAAACATAAATGACCCCATGG - Intronic
1124938668 15:34197309-34197331 TTAAAACAGGACTTAAACCCAGG - Intronic
1125211101 15:37216235-37216257 TTTAAAGAAAAGAGAAACCAGGG + Intergenic
1125261196 15:37826905-37826927 AAAAAATAGAAGGGAAACCAGGG + Intergenic
1126011644 15:44308549-44308571 ACATAAAAGAAGTGAAACCAGGG - Intronic
1126421725 15:48480833-48480855 TTAAAACATAATGGAAACCATGG - Intronic
1126640045 15:50815219-50815241 TTAAAAAAGAATTAAAAGCAGGG - Intergenic
1126983086 15:54269025-54269047 TTAAAAAAAAAAAGAAACCAAGG - Intronic
1127587150 15:60389226-60389248 GTAAAACAAAAGCAAAACCAGGG + Intronic
1127860334 15:62988656-62988678 TTAAAAGAAAATTAAAACCAAGG + Intergenic
1128011532 15:64301585-64301607 TTAAAACTTAAGTGAAAAGAAGG + Intronic
1129611471 15:77062307-77062329 TTAAGTCAGAGGTGAAAGCATGG - Intronic
1130171253 15:81516950-81516972 TTAAAAAAAAAATGAAACCTAGG + Intergenic
1130693552 15:86107235-86107257 TAAGAACAGAACAGAAACCATGG - Intergenic
1131638261 15:94260683-94260705 TTGAAACTGAAGTGAAATAAAGG - Intronic
1131718573 15:95141555-95141577 TAAAAGCAGAAGTCCAACCAGGG + Intergenic
1133075264 16:3275406-3275428 TTAAAACAAAAATAAAACCCAGG + Intronic
1133819263 16:9222118-9222140 TTATACCAGATGGGAAACCAAGG + Intergenic
1136006197 16:27330955-27330977 TAAAATCAGAAATGAGACCAGGG - Intronic
1138224983 16:55285367-55285389 TTAAATCAAAAGAGAAACAATGG + Intergenic
1138430931 16:56968689-56968711 TAAAAACAGAAATAAAAGCAAGG - Intronic
1139074424 16:63426621-63426643 TTAGAGCAGAAGTGAAAGAAAGG + Intergenic
1139114364 16:63931575-63931597 TTAGAACAGGAGATAAACCATGG + Intergenic
1140283432 16:73576605-73576627 TTAAAACAGAACTGTCAGCAGGG - Intergenic
1140396107 16:74628166-74628188 TTAGAACAGTAGTGGAACAAGGG - Intronic
1141270377 16:82534631-82534653 GTAAGACAAAAGTGAAACAATGG + Intergenic
1141945766 16:87308704-87308726 TTGTAACAGGAGTGAAAACATGG - Intronic
1145817771 17:27807891-27807913 TAAAAACAGAGTGGAAACCAGGG + Intronic
1147646409 17:42036921-42036943 TGAAAACTCAAGTGAAATCATGG - Intronic
1150920185 17:69474799-69474821 ATAAAGAAGAAGTGAATCCATGG - Intronic
1151102692 17:71573934-71573956 TTAAAACAAAATTTAAAACAGGG - Intergenic
1151670024 17:75566974-75566996 AAAAAAGAGATGTGAAACCAGGG + Intronic
1152845415 17:82596797-82596819 ATAAAACAAACGTGAAATCAAGG - Intronic
1153110649 18:1582422-1582444 TTGAAACAGATTTGTAACCATGG - Intergenic
1153803081 18:8688656-8688678 TGAAATCAGGAGTGAAAACATGG + Intergenic
1155044887 18:22095050-22095072 TAAAACCAGGAGTGATACCATGG + Intronic
1155283837 18:24268717-24268739 TTAAAAGACAAGTGAAAGAAAGG - Intronic
1155813468 18:30271041-30271063 TAAAAACAGAAGGGAAACAAAGG + Intergenic
1156258370 18:35421579-35421601 ATAAAACAGAAATGAAAACGAGG - Intergenic
1156413137 18:36855751-36855773 TTAAAACAGAAGAAAACACAGGG - Intronic
1156921085 18:42523073-42523095 TTAAAACAAAAATGAAAAGAAGG - Intergenic
1157022132 18:43796892-43796914 TCAAAACAGAAGTTAAAAAAGGG + Intergenic
1157043671 18:44069052-44069074 TTAAAAAATAAATGAAAGCAAGG - Intergenic
1157346562 18:46841354-46841376 TTAAATAAGAAGTGAACCCTGGG - Intronic
1158309052 18:56139356-56139378 TTTAGACAGAAGAGAAAACAGGG + Intergenic
1159005295 18:63005240-63005262 TTAACACAAAGCTGAAACCAGGG + Intergenic
1159062123 18:63526699-63526721 TGAAAAGAGAGGTGAAAACATGG - Intergenic
1159144686 18:64439433-64439455 TTAAAAGAGTAATCAAACCAAGG - Intergenic
1159220259 18:65452881-65452903 GAAAAACAGAAGTCACACCAAGG + Intergenic
1159379298 18:67636088-67636110 GTAAAACGTAAGTGAAAACAGGG - Intergenic
1159661775 18:71105867-71105889 TTAGAACAGAGGTGAGTCCAAGG + Intergenic
1160290929 18:77592555-77592577 TTAAAGCAGAATTGAACCCGGGG + Intergenic
1164445837 19:28316931-28316953 TGTAAACAAAGGTGAAACCATGG - Intergenic
1165123766 19:33580050-33580072 TTAAAATACAAAAGAAACCAGGG + Intergenic
1167723209 19:51193089-51193111 TTAAAACAGGAGAGCAACAAAGG + Intergenic
925340672 2:3133256-3133278 TTGAAAGAGAACTGAAATCAGGG + Intergenic
925605303 2:5654206-5654228 TGGGAACAGAAGTGAAGCCAAGG - Intergenic
927010079 2:18894413-18894435 GGAAAACAGGAGTGAAAACAAGG - Intergenic
929386957 2:41420463-41420485 TAAAAGCAGAAGTGACTCCAAGG - Intergenic
929860566 2:45673739-45673761 TGAAAATAGAAGTGCAAACAAGG + Intronic
930490513 2:52063767-52063789 TTAAAACAGAAGTACATCCGTGG + Intergenic
930958963 2:57235229-57235251 CTAAAGCAGAAATTAAACCAAGG + Intergenic
931742747 2:65262661-65262683 TTAAGAGTGAAGTCAAACCAGGG + Intronic
932963131 2:76439189-76439211 TTAAAACAAAAATGAAATTAAGG - Intergenic
933074308 2:77904005-77904027 TTAAAACTGAAGAGAGACAAGGG - Intergenic
933083542 2:78024774-78024796 TGAAAACACAAGTGAAATGAAGG + Intergenic
934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG + Intergenic
934087687 2:88524207-88524229 ATAAAAAAGAATTGAAAGCAAGG - Intergenic
934480747 2:94640811-94640833 TTAAAACAAAACTAAAACCTAGG - Intergenic
935286703 2:101570882-101570904 TAAAATCAGAAATGAAAGCAAGG - Intergenic
935640511 2:105285583-105285605 GTACAACAGAAGTGGAACCTCGG + Intronic
935823869 2:106922131-106922153 TTCAAAAAGAAATGAAAGCAGGG - Intergenic
937405354 2:121622664-121622686 ATAATTCAAAAGTGAAACCAAGG - Intronic
938207275 2:129434660-129434682 TTAAAACTCAAGAGTAACCATGG - Intergenic
938746056 2:134279309-134279331 TCAAAAGTGAAGTGAAACAAAGG - Intronic
938888505 2:135678643-135678665 TTAGAACAGAACTTAAAACATGG + Intronic
939912367 2:147998923-147998945 ATAAAACAGAAATGAAAGGATGG + Intronic
940076327 2:149746379-149746401 TGAAGACAGAAGGGAGACCAAGG + Intergenic
940552026 2:155171430-155171452 TAAAGAGAGAAGTGCAACCATGG - Intergenic
940633114 2:156263661-156263683 TTAAATGAGATGTGAAAGCATGG - Intergenic
940645993 2:156393608-156393630 TCAAAGCAGAAATCAAACCAAGG - Intergenic
940799065 2:158113406-158113428 TTAAAACTCACCTGAAACCATGG + Intronic
940903669 2:159149251-159149273 TGAAGACAAAAATGAAACCATGG + Exonic
941283842 2:163584554-163584576 TTAAAAAAAAATTGAACCCAGGG - Intergenic
942964837 2:181879415-181879437 TTAAAACATAAGTCAGCCCATGG + Intergenic
943164538 2:184303208-184303230 TTAAAACAAGAGTTTAACCAAGG + Intergenic
943606121 2:189978627-189978649 TTAAAAAATAAGTGAAAACATGG + Intronic
943635055 2:190297471-190297493 TTAAAACATTAGTGGAACAAAGG + Intronic
944241852 2:197493545-197493567 TTAAATGAAAAGCGAAACCAAGG + Intronic
944446494 2:199796155-199796177 TTTAAACAGAATTAAAAACAAGG + Intronic
944689165 2:202144256-202144278 TTGAAACAGAAGTGAAGAAAGGG - Intronic
945365203 2:208944497-208944519 CTTACAGAGAAGTGAAACCATGG + Intergenic
945399856 2:209367934-209367956 TTAAATCAGAAGTCATACTAAGG + Intergenic
946401443 2:219470538-219470560 TTATAAGAGAAGAGAAGCCAAGG - Intronic
946413555 2:219527609-219527631 TTCAAACAGAACTGAACCCCAGG - Intronic
946580744 2:221125987-221126009 TTAAAACTGAAGTGTAACAGTGG - Intergenic
946581601 2:221134002-221134024 TAGAAACAGTAGTAAAACCAGGG - Intergenic
947517812 2:230822569-230822591 TAAAAAAAGAAAAGAAACCAGGG - Intergenic
948155033 2:235774567-235774589 TTAAAATGGAAATGAAGCCAGGG + Intronic
948217762 2:236244471-236244493 GGAAAACAGATGTGAAATCAAGG + Intronic
948249855 2:236518385-236518407 ATAAAACAAAAGTGAAGCTAGGG + Intergenic
1169578710 20:6994965-6994987 TAGAAGCAGAAGTGAAGCCAGGG + Intergenic
1169686564 20:8280355-8280377 TTTAAAAAGAAGTGAAAAAAGGG + Intronic
1170296326 20:14830655-14830677 TTAAAAGTGAACTGAAACAAGGG + Intronic
1170949421 20:20923096-20923118 TTAAGACAGAAGTGAAACAATGG - Intergenic
1172712394 20:36935913-36935935 TTAAAACAGAAAAGAAAGAAGGG + Intronic
1173274172 20:41565050-41565072 ATAAAACAGAAGAGAAGTCATGG + Intronic
1173382076 20:42554614-42554636 TGAAAACTGAAGTGAAATTATGG + Intronic
1173690537 20:44957539-44957561 TTTAAAAAGAATTGAAAACAGGG + Intronic
1174882721 20:54298144-54298166 TTAAAAAAGAAATCACACCAAGG + Intergenic
1175354401 20:58352034-58352056 GTAAAACAGACATGAAAACAAGG + Intronic
1175454238 20:59098371-59098393 ATAAAACCGAATTTAAACCATGG - Intergenic
1176515399 21:7780103-7780125 TTAAAACAGAACTGAAACATTGG - Intergenic
1176588810 21:8620019-8620041 TTAAAACAGAAGAGATATTATGG + Intergenic
1177011188 21:15731277-15731299 TAAAAAAAGAAGTTAAATCATGG - Intronic
1177263815 21:18759185-18759207 CTAAATCAGAAGGGACACCAGGG + Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1178167168 21:29992250-29992272 TTAAAACAGAAATGAAATATAGG - Intergenic
1178240365 21:30892979-30893001 TTAAAAAAAAAATTAAACCAAGG + Intergenic
1178254026 21:31034240-31034262 TTAAAACAGAAATGGAGCAAGGG + Intergenic
1178649427 21:34410115-34410137 TTAAAACAGAACTGAAACATTGG - Intergenic
1178784392 21:35639214-35639236 TTAAAAAATAAGTCAAGCCAAGG + Intronic
1178998893 21:37435457-37435479 TTAGAACAGAAGTGGAAATAAGG + Intronic
1179943879 21:44657625-44657647 ATGAAACAAAAGTGAAACAACGG + Intronic
1180271636 22:10597015-10597037 TTAAAACAGAAGAGATATTATGG + Intergenic
1182778255 22:32847104-32847126 TTAACACAGAAGGTAAACAAGGG - Intronic
1183118251 22:35708638-35708660 TTGGAACAGAACTGTAACCATGG - Intergenic
1183145246 22:35984482-35984504 ATATAACAGATGTGAAACAAGGG - Intronic
1183677481 22:39307576-39307598 TGAAAACAGAAGTGATGCCGGGG + Intergenic
949138511 3:601750-601772 TTAAAACAGAAGAGATATTATGG - Intergenic
949278621 3:2319415-2319437 TTAAAATAAAAGTTACACCAAGG + Intronic
949466671 3:4351671-4351693 TTAAAAAAGAAGTGACACATGGG + Intronic
950928505 3:16766591-16766613 TTATAACAGCAGAGAAACCAGGG + Intergenic
951352095 3:21618759-21618781 GCAATACAGTAGTGAAACCAAGG + Intronic
951590511 3:24259368-24259390 TTCATGCAAAAGTGAAACCATGG + Intronic
951653791 3:24981983-24982005 TTAAGACAAAAGGGAAACCTGGG + Intergenic
953247310 3:41206123-41206145 CTAAAACAGAAGTAAAACCGTGG - Intronic
953946443 3:47152621-47152643 TCAAAACACAAGTTAGACCACGG + Intronic
955248147 3:57248567-57248589 TGATAAAAGAAGTGAAACCAGGG + Intronic
955386227 3:58483110-58483132 TAAATATAGAAGTGAAACCCTGG - Intergenic
955657087 3:61255856-61255878 TTAAAGCTGCAGTGAAACCAGGG - Intergenic
955726381 3:61937315-61937337 TTGCGACAGCAGTGAAACCAGGG - Intronic
955865318 3:63376027-63376049 AGAAAACAGAAGAGAAACCAAGG - Intronic
956739339 3:72262966-72262988 TTAAAACAGAATCCAAATCAGGG + Intergenic
957541219 3:81571787-81571809 CTAAAGAAGAAGTCAAACCAGGG + Intronic
957697166 3:83654161-83654183 TTAAAACAGCTGAGAAACTAAGG + Intergenic
957741537 3:84276786-84276808 TTAAAGTAGAAGTAAAACAAGGG + Intergenic
958455399 3:94325031-94325053 CTAAGACAGGATTGAAACCAAGG + Intergenic
958707882 3:97678788-97678810 TCAAAACAAAAGTGAAATCAGGG - Intronic
958753567 3:98222726-98222748 TTAAAAAAGAAGTCTAACAAAGG + Intergenic
959945405 3:112120439-112120461 TTAAAACAGAAGAGAAAAATAGG - Intronic
959966561 3:112362172-112362194 GAAGAACAGCAGTGAAACCAAGG - Intronic
961011708 3:123440734-123440756 ATAAACCAGAAGTCAAACCTAGG + Intronic
961939990 3:130626965-130626987 TTAAAATAGAAGTGTTATCAGGG + Intronic
962384762 3:134923682-134923704 TTAAAACAGAAGTGATAAATGGG - Intronic
962423005 3:135244476-135244498 TGAAAACAGAAGTGAATTCTGGG - Intronic
963757048 3:149245882-149245904 TGAAACCAGAAGTGAAAGCTAGG - Intergenic
964427738 3:156571056-156571078 TTGAATTAGAAGTGAAACGAGGG - Intergenic
964543675 3:157808292-157808314 TTTAAACAAAATTGTAACCATGG + Intergenic
965334198 3:167416042-167416064 CTAAAACAGAAGTTAAAAAAAGG - Intergenic
965418069 3:168422187-168422209 ATAACACAGAAATGAAAGCAAGG + Intergenic
966522871 3:180892432-180892454 TTAAGAAAGAACTGAAAGCAAGG - Intronic
966719093 3:183043610-183043632 TTCAAACAGAGGTAAAACAAAGG - Intronic
967215983 3:187210876-187210898 TTAAACCAGGTCTGAAACCAAGG - Intergenic
967341362 3:188402339-188402361 TCAAAACACAAGTGTAACAAAGG + Intronic
967798525 3:193627228-193627250 TGAAAACATAAATGAAACTATGG - Intronic
968539569 4:1157604-1157626 TGAACACTGAAATGAAACCAAGG - Intergenic
968714749 4:2148226-2148248 TTGAAACAGAAGAAAATCCAAGG + Intronic
970959096 4:21851868-21851890 TTAAGACAGAACTGAGACGAGGG - Intronic
971033505 4:22667141-22667163 TGAAAACAGAAGAAAAATCAAGG - Intergenic
971435049 4:26611971-26611993 TTAGAGCAGAAGTTAAAACAGGG - Intronic
971518810 4:27522731-27522753 TTAAAAAATAATTGTAACCAGGG - Intergenic
972202246 4:36727497-36727519 TTAAGACAGGAGTGAAACCTGGG - Intergenic
972280837 4:37600683-37600705 TTAATACAAAACAGAAACCATGG + Intronic
972656674 4:41070191-41070213 CTAAAACAGACCTGCAACCAAGG - Intronic
973248531 4:48036978-48037000 TTAAAACAGAAGTGAAACCACGG + Exonic
973804323 4:54510871-54510893 TTACAAAAGAAGTGAAGGCAAGG - Intergenic
973989939 4:56394743-56394765 TAAAATCAGAAGTGAAATGATGG + Exonic
974303002 4:60093942-60093964 ATATGACAAAAGTGAAACCATGG - Intergenic
974561735 4:63531953-63531975 TGGAAACAGAAGTAAAACAAAGG + Intergenic
974568933 4:63618358-63618380 TTAAGAAAGAAGTGACACAAGGG - Intergenic
975503424 4:75112211-75112233 ATAAAACAGATTTTAAACCAAGG + Intergenic
975562320 4:75719587-75719609 TCAAAAAAGAAATGAGACCAAGG - Intronic
976151453 4:82096675-82096697 TTAAAAAAGAAGTGCATCCCAGG + Intergenic
976498996 4:85764652-85764674 TGAATACAGAGGAGAAACCAAGG + Intronic
977125629 4:93163924-93163946 TTAATACAGAAGTTATAGCATGG + Intronic
978045208 4:104117040-104117062 TTGAAAGAGAATTGCAACCAAGG - Intergenic
978541389 4:109819965-109819987 ATAAAACACAATTGAAACTAAGG - Intronic
979550299 4:121983484-121983506 TTAGAATAGCAGTTAAACCAGGG + Intergenic
980023447 4:127736476-127736498 TTAAAGCAGAAGTGATACAATGG - Intronic
980485190 4:133448384-133448406 CCAAAACTGAAGTGAAACAAAGG - Intergenic
980819738 4:137998057-137998079 TTTAAAAGGAAGGGAAACCATGG + Intergenic
980917545 4:139048039-139048061 TTCAACCGGAAGAGAAACCATGG + Intronic
981482294 4:145251499-145251521 TTTATACAGAAGTTAAGCCATGG - Intergenic
981559534 4:146032314-146032336 TTACAACAGATCTGAAAACAAGG + Intergenic
981881257 4:149615813-149615835 TTAAAAGAGGAGTGGAAACAAGG - Intergenic
982264279 4:153524115-153524137 AAAAAACAGAAGTGAAACATGGG - Intronic
982493111 4:156054542-156054564 GTAAAACATAAATGAAAGCATGG + Intergenic
982923214 4:161303243-161303265 TTAAAAGAGAAGAAAAACAAAGG - Intergenic
983644601 4:169977119-169977141 TTAAGACAGAAGGAAAACAAAGG + Intergenic
983735579 4:171055226-171055248 TAAAAACAGAATTAGAACCAGGG - Intergenic
987665220 5:20929038-20929060 TAAAATCAGAAGTGAAAAAAGGG - Intergenic
988296176 5:29365594-29365616 ATAAAACAGTAGTGTTACCAGGG - Intergenic
988610801 5:32722761-32722783 TCAAATCAGAGGTGAAACAAGGG + Intronic
988757469 5:34273145-34273167 TAAAATCAGAAGTGAAAAAAGGG + Intergenic
989639768 5:43571724-43571746 TGAAAACAGAAGAAAAACAAAGG + Intergenic
989775197 5:45198347-45198369 TAAAAACCGCAGTGAGACCAAGG + Intergenic
989830421 5:45910668-45910690 TAAAAACAAAAGTTAAACAAAGG - Intergenic
989986384 5:50703631-50703653 TTAAAACAGTAGAGAACACATGG - Intronic
990058188 5:51612096-51612118 TGAAAGGAGAAGTGAAAGCAGGG + Intergenic
990263234 5:54047981-54048003 CAAAAACAGAAATGAAACAAAGG - Intronic
991118849 5:62987180-62987202 ATAAAAGAGCAATGAAACCAAGG + Intergenic
991328902 5:65469936-65469958 TAAACACAGAAGAGAAAGCATGG + Intronic
991659346 5:68934508-68934530 TTAAAAAGGAAGTGGTACCATGG - Intergenic
991693262 5:69245898-69245920 TAAAAACAGATGTGAAAAAAGGG - Intronic
993716511 5:91280286-91280308 GTACAACGGAAGTGAAACCTGGG + Intergenic
993905975 5:93623118-93623140 TTATTACTGAAGTGAAACTAGGG - Intronic
993979100 5:94521835-94521857 TTACAAGAGAAATGAAAGCAAGG + Intronic
994368828 5:98946556-98946578 TTAAAATACAATTGAAGCCAAGG - Intergenic
994650321 5:102519318-102519340 TGGAATCAGAAGTGAAGCCAAGG - Intergenic
994733901 5:103528055-103528077 TTATTACAGAAGTGAAACGTGGG - Intergenic
994787709 5:104185991-104186013 TTAGAACAGAAATGAAAGAAAGG - Intergenic
995901801 5:117078039-117078061 TTTAAACAGAAGGTAAACAAAGG + Intergenic
996233284 5:121092840-121092862 TTAAAAAAGAAGAGATATCAGGG - Intergenic
999214442 5:149920247-149920269 TAAAAACAAAAATGAAAGCAGGG + Intronic
999312684 5:150561924-150561946 CTAAAACAGAAGTACAAACAGGG + Intergenic
999521521 5:152355612-152355634 GTAAAACAGGAATGAAAACAAGG - Intergenic
999949796 5:156636548-156636570 TGATAACTGAAGGGAAACCAGGG + Intronic
1000620790 5:163483961-163483983 TAAAAACACAAATGAAAACAAGG - Intronic
1000957142 5:167556828-167556850 CTAAAATACAAGTGAGACCAAGG - Intronic
1001294764 5:170491318-170491340 TTCTAGCAGAAGTGAAAACAAGG + Intronic
1002791054 6:437954-437976 TTCTAAAAGAAGTGAAAGCAGGG - Intergenic
1003710463 6:8583948-8583970 GCAAAAAACAAGTGAAACCAGGG + Intergenic
1004009719 6:11671062-11671084 CTAAAACAGAAGAGAAAGAAAGG + Intergenic
1004956278 6:20731244-20731266 TTAAAACAGAAGCCAGAACATGG - Intronic
1005609308 6:27508442-27508464 TTAAAATGGTAGTGAAACCCAGG + Intergenic
1005646184 6:27840603-27840625 TAAACTCAGAAGTAAAACCATGG + Intronic
1006052022 6:31352614-31352636 TTAAAACAGAAGTCATATCATGG + Intronic
1007783460 6:44267113-44267135 ATAAGACAGAAGTGAGAACAGGG + Intergenic
1007889541 6:45273558-45273580 TTAAAAAAAATGTGAAACCCAGG + Intronic
1008568454 6:52792306-52792328 TCTAAGCAGAAGTGAAAACATGG + Intronic
1009516946 6:64632240-64632262 TTAAAAAAGAAGATAAATCACGG - Intronic
1009812904 6:68692545-68692567 TTAAAACAGAAAATATACCAGGG + Intronic
1010342817 6:74776308-74776330 ATAAAACAGAAGTGAGAACATGG - Intergenic
1010808291 6:80265208-80265230 ATACAAAAGAAGTGAAAGCAGGG + Intronic
1011099119 6:83702121-83702143 TTATAAAAGAAATGAAACTAAGG + Intronic
1012253827 6:97009459-97009481 TTAAAACAGAAGCAACAGCATGG - Intronic
1013721776 6:113039107-113039129 CAAAAACAGAAGTGAAGCCCAGG + Intergenic
1013774180 6:113660828-113660850 TTAAAAAAGAAGTGAGACCTGGG - Intergenic
1014300212 6:119672445-119672467 TAAAGACTGAAGTGTAACCAAGG + Intergenic
1015020956 6:128474244-128474266 TTAAAGCAGAGGTGACATCACGG + Intronic
1015275465 6:131379233-131379255 TTACAAAAGAATTGAAAGCATGG + Intergenic
1015965837 6:138694114-138694136 GTAAAACAGAGGAGCAACCAGGG - Intergenic
1016107647 6:140182323-140182345 TTAAAATACAAATGAAAACATGG - Intergenic
1016391074 6:143576527-143576549 TTAAAACAGAAGTTGAAAGAGGG + Intronic
1017081588 6:150674565-150674587 TTGAAACAAAAGTGAAACTCAGG - Intronic
1017347013 6:153395825-153395847 TTAAAACAGACTTGAAATCAGGG - Intergenic
1017703828 6:157101535-157101557 TGAAAAGACATGTGAAACCATGG - Intronic
1017710815 6:157166132-157166154 TAAAAACAGAAATGATAGCAAGG - Intronic
1018522779 6:164669765-164669787 TAAAAACAGAAATGAAACATCGG + Intergenic
1020520242 7:9176107-9176129 TTTAAATAGAATTTAAACCAAGG - Intergenic
1021076686 7:16313412-16313434 TTAATACAGAAATGAAAGCACGG - Intronic
1023585140 7:41721782-41721804 TTAAAACAAAAGTAAAAGGAAGG - Intergenic
1024607668 7:51035834-51035856 TTAAAACACATGTGAGACCTTGG - Intronic
1024645799 7:51369344-51369366 TTCAGACAGAAGTGGTACCACGG - Intergenic
1025036657 7:55597461-55597483 TTCAGACAGAAGTGGTACCACGG - Intergenic
1025699453 7:63803918-63803940 TGAAAAGAGAAATGAAAACAGGG - Intergenic
1025831213 7:65052261-65052283 TGAAAAGAGAAATGAAAACAGGG - Intergenic
1025888642 7:65623634-65623656 CTAAAACAGAAATGAAAACTGGG - Intergenic
1025918362 7:65886141-65886163 TGAAAAGAGAAATGAAAACAGGG - Intronic
1026544087 7:71306804-71306826 ACAAAACAGAAATGAAAACAGGG - Intronic
1027582741 7:80019536-80019558 TTAAAAGAGAAGTGTAGGCATGG + Intergenic
1027850834 7:83449811-83449833 TTAAAACAAAATTTAAAACAAGG - Intronic
1029803303 7:102973106-102973128 TTCACATAGAAGTGAAATCATGG - Intronic
1030889082 7:114975508-114975530 TTAAAACACAAGTGATGCCTAGG - Intronic
1031068799 7:117139113-117139135 TTAAAACAAAAGAGAACCAAGGG + Intronic
1031718861 7:125143445-125143467 TAAAAACAGAAGTAATACCTGGG + Intergenic
1031853806 7:126898322-126898344 CTAAAACAGAAATGAAAACTGGG + Intronic
1032461923 7:132118148-132118170 TAAAAGCAGAAGTGAGACAAGGG - Intergenic
1033226257 7:139564963-139564985 TTACAACAAAAATTAAACCAAGG - Exonic
1033431927 7:141297237-141297259 TTAAAGTAGAAGTTAAACAAAGG + Intronic
1033535149 7:142305524-142305546 ATAGAATGGAAGTGAAACCATGG + Intergenic
1033950943 7:146783992-146784014 GAAACACAGTAGTGAAACCATGG - Intronic
1034691640 7:153018787-153018809 TTAAAACTTAATTTAAACCACGG - Intergenic
1034712947 7:153211787-153211809 TAAAATCAGAAATGAAAGCAGGG - Intergenic
1034975172 7:155444694-155444716 TTAAAAAAGAAGTGTATCCCAGG + Intergenic
1037220782 8:16517893-16517915 TTAACAAAGATGTGAAACAAAGG + Intronic
1038435085 8:27529936-27529958 TTTAACCAGAAGAGAAACTAAGG + Intronic
1040511746 8:48102157-48102179 TGAACACATAAGTGAAACCTAGG + Intergenic
1040807805 8:51413099-51413121 GTAGAACAGAAATGAAAACAAGG + Intronic
1041266182 8:56067383-56067405 TTAAAAAAGAAGAAAAATCATGG + Exonic
1041457338 8:58074968-58074990 TTAAAACAGACATTTAACCATGG - Intronic
1042155067 8:65836043-65836065 TGAAAACAGAAATGAAGCCAAGG + Intronic
1042512963 8:69630545-69630567 TTTAAACAGAAATGCAAACATGG - Intronic
1043682976 8:83054337-83054359 TTAAAACAGAACTGACTCCATGG + Intergenic
1044482989 8:92714562-92714584 ACAAAACAGAAGTGAAATTATGG - Intergenic
1044738848 8:95305087-95305109 TTAAAACAAATGCAAAACCAAGG + Intergenic
1045200870 8:99979894-99979916 TTACAACAGAGGTAAAAACAAGG + Intronic
1046344934 8:112911077-112911099 TTGAAACAGAAGTGAATTGAGGG - Intronic
1046662142 8:116959325-116959347 TTAAAAGATAAGTGGAAACATGG - Intronic
1046794573 8:118357016-118357038 TGAGAGCAGAAATGAAACCAAGG - Intronic
1047552308 8:125888059-125888081 TTGAAACAGAATTGGAACCCAGG - Intergenic
1047736305 8:127768162-127768184 TGAAAAAAGAATTGCAACCAAGG - Intergenic
1047783707 8:128133235-128133257 TTCAAACAGAACTTAGACCAAGG + Intergenic
1048386642 8:133918415-133918437 TTAAAATAGAAGGAAATCCAAGG - Intergenic
1050208361 9:3223791-3223813 TTAAAACAGAACTGAAGCTAAGG - Exonic
1050585870 9:7110786-7110808 TTTAAACCGACCTGAAACCAAGG + Intergenic
1050671314 9:8000533-8000555 TTTAAACAGAAAAGAACCCAAGG - Intergenic
1051548330 9:18301669-18301691 TGAAAAGAAAAGTTAAACCATGG + Intergenic
1051966930 9:22839661-22839683 TATAAACAGAAGTATAACCATGG - Intergenic
1052130147 9:24834663-24834685 TTAAAAAAGAAGCAAAATCAAGG - Intergenic
1052389815 9:27866605-27866627 TTAAAACAGAATTTAAGCAAAGG - Intergenic
1053114896 9:35491472-35491494 TCAAAACAGAAGAGAAACAGTGG - Intronic
1053677089 9:40443155-40443177 TTAAAACAAAACTAAAACCTAGG + Intergenic
1053926854 9:43069255-43069277 TTAAAACAAAACTAAAACCTAGG + Intergenic
1054286628 9:63181750-63181772 TTAAAACAAAACTAAAACCTAGG - Intergenic
1054290161 9:63278684-63278706 TTAAAACAAAACTAAAACCTAGG + Intergenic
1054388189 9:64583224-64583246 TTAAAACAAAACTAAAACCTAGG + Intergenic
1054507534 9:65933144-65933166 TTAAAACAAAACTAAAACCTAGG - Intergenic
1055482427 9:76722845-76722867 ATAAAACAGGAGTGAAAACATGG - Intronic
1056700731 9:88904557-88904579 TTAAGACAGACATGAAACTACGG - Intergenic
1056871310 9:90282896-90282918 ATAAAAAAGAATTGAAAACAGGG + Intergenic
1056972932 9:91223556-91223578 TGAAAGCAGAATTGAAAGCAGGG - Intronic
1057174499 9:92986133-92986155 TTAAAACAGAGATGAAGGCAAGG - Intronic
1059064809 9:111072162-111072184 TGAGAATATAAGTGAAACCATGG + Intergenic
1059082276 9:111262858-111262880 TTTAAAAAGCAGAGAAACCAAGG - Intergenic
1059161677 9:112040656-112040678 TTAAAACAGTATTGAGCCCATGG - Intergenic
1059705042 9:116814933-116814955 TTTAAAAAGAAGAGAAAACAAGG + Intronic
1061149895 9:128822717-128822739 GTGAAGCAGCAGTGAAACCAGGG - Exonic
1061161158 9:128895025-128895047 AGAAAACAGAAGGGATACCAGGG - Intronic
1203618817 Un_KI270749v1:98598-98620 TTAAAACAGAAGAGATATTATGG + Intergenic
1186854808 X:13615976-13615998 TTTAGAGAGAAGTGAAACAATGG - Intronic
1190100846 X:47521889-47521911 ATAAAAAAGAATTGAAAGCAGGG + Intergenic
1190451528 X:50586223-50586245 TTAAAACTGAGGAGAAATCAGGG + Intergenic
1190770360 X:53509030-53509052 TGAAAACAGAAGAAAAACAAGGG - Intergenic
1192140855 X:68646519-68646541 CTGAAACAGAAGTGAGGCCAGGG + Intergenic
1193331151 X:80237030-80237052 TTAAAACAGAGATGATAGCAAGG - Intergenic
1193453226 X:81697112-81697134 TTAAAAAAAAAGTCAAGCCAAGG + Intergenic
1193877377 X:86877382-86877404 ATAAAACAGACTTAAAACCAAGG - Intergenic
1193932191 X:87567057-87567079 TTAAAATAGAAGTTAAAAAAAGG + Intronic
1195603419 X:106774304-106774326 TAAAAACAGAAGACAAAGCAGGG - Intronic
1195859411 X:109365567-109365589 TTCAAACAGAAGTTAAATGATGG - Intergenic
1195909852 X:109878047-109878069 TTTAAATAGATGAGAAACCAAGG - Intergenic
1196076095 X:111577849-111577871 TGAAAACAGAAGAAAAACAAAGG - Intergenic
1196581061 X:117379561-117379583 TTAAAAAGGAAGTGAAGACAAGG + Intergenic
1196942299 X:120789098-120789120 CTAAAACAAAAATCAAACCATGG - Intergenic
1197159409 X:123307008-123307030 TTAGAAAAGAAGTGAAGCCATGG - Intronic
1197532723 X:127650007-127650029 TAAAAACAGATGGGAGACCAGGG - Intergenic
1198512686 X:137369524-137369546 ATAAAATGGAAATGAAACCAAGG - Intergenic
1198559073 X:137828948-137828970 TGAAAACAGATGTGACAACATGG - Intergenic
1199407496 X:147479604-147479626 TTTAACCAGAAGGGAAAACATGG + Intergenic
1200010587 X:153117797-153117819 CTAAATCAGAAATGAAAGCAAGG - Intergenic
1200029013 X:153282125-153282147 CTAAATCAGAAATGAAAGCAAGG + Intergenic