ID: 973261373

View in Genome Browser
Species Human (GRCh38)
Location 4:48167735-48167757
Sequence TGTGATATGCAGTGGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973261373 Original CRISPR TGTGATATGCAGTGGGTAGG TGG (reversed) Intronic
902089077 1:13888686-13888708 AGAGGTATGCAGTGGCTAGGTGG + Intergenic
902437566 1:16408328-16408350 GGTGAGATGCAGTGGGAATGGGG + Intronic
902670139 1:17967560-17967582 AGTGATATCCAGTGAGTGGGTGG - Intergenic
903042429 1:20541504-20541526 TGGGATCTGCAGTGGGGAAGGGG - Intergenic
903060385 1:20664754-20664776 TGTGATGTGCTGTGGGGAAGAGG + Exonic
903320229 1:22538728-22538750 TGTGAAATGGGGAGGGTAGGGGG + Intergenic
903385690 1:22924668-22924690 TGTGATTGGTAGAGGGTAGGGGG - Intergenic
904288395 1:29468428-29468450 AGTGGAATGGAGTGGGTAGGTGG - Intergenic
907457723 1:54586099-54586121 TGTTCTGTGCAGTGGGTGGGTGG + Intronic
912745132 1:112239704-112239726 AGTGACATGCAGTGGGAAGGAGG + Intergenic
912752913 1:112300334-112300356 TGATATTTGGAGTGGGTAGGGGG + Intergenic
913274094 1:117121403-117121425 TGTGGGATGCAGTGGAAAGGAGG - Exonic
914859191 1:151372462-151372484 TGGGAAATGCAGTGGGGTGGTGG + Intronic
915746608 1:158164868-158164890 TGTAATATGCACTGGTTTGGGGG + Intergenic
922203394 1:223426000-223426022 TGTGCTATGGAGCGGGAAGGTGG - Intergenic
1063681758 10:8194989-8195011 TGTGCTATGTAATGGGTATGGGG - Intergenic
1063920566 10:10928105-10928127 TGTGATAGGAAGTGTGTTGGGGG - Intergenic
1067834390 10:49629152-49629174 CCTTATAGGCAGTGGGTAGGAGG - Intronic
1068309764 10:55262662-55262684 AGGGAGATGCAGTGGGAAGGTGG - Intronic
1070515430 10:77201079-77201101 TGGGGTGTGCAGGGGGTAGGGGG + Intronic
1071000820 10:80828580-80828602 TGGGATCTGCTGTGGGGAGGAGG - Intergenic
1074946166 10:118282899-118282921 TGTGATATGTGGTGTGTGGGGGG - Intergenic
1075190826 10:120306959-120306981 TGTTATTTGCAGTGGGTTGGGGG + Intergenic
1075320001 10:121483832-121483854 TTTCATATGCACTGGGTACGTGG + Intronic
1075797464 10:125130926-125130948 TTTGAGATACAGTGGGTCGGAGG - Intronic
1077430681 11:2514471-2514493 TGTTCTCTGTAGTGGGTAGGAGG + Intronic
1079533180 11:21479537-21479559 TGGGAAAGGTAGTGGGTAGGAGG + Intronic
1082788067 11:57328248-57328270 TGTGTGGTGCAGTGGGTGGGGGG - Intronic
1084502281 11:69541836-69541858 TATGATGGGCAGTGGGGAGGGGG + Intergenic
1087333758 11:96816407-96816429 TGTGATAAGCAGTTTGTGGGGGG - Intergenic
1090003712 11:122982390-122982412 AGTTATAGGCAGTGGGCAGGAGG + Intergenic
1090249281 11:125240149-125240171 AGTGAGATGGAGTGGGGAGGGGG + Intronic
1096183443 12:49563851-49563873 GGTGGTAGGCAGTGGCTAGGGGG - Intronic
1097299673 12:58004794-58004816 GGTGATATCCAGTAGATAGGGGG + Intergenic
1097913777 12:64998566-64998588 TGTGAAATCCAGTTGTTAGGTGG - Intergenic
1098359802 12:69643244-69643266 TTTGGTCTGCAGTGGGAAGGTGG - Intergenic
1098382813 12:69886683-69886705 TGTCATGTGCTGGGGGTAGGAGG - Intronic
1098467110 12:70800230-70800252 TCTAAAATGCAGTGGGTAGGGGG - Intronic
1098799678 12:74939407-74939429 TGTGAAATGCGGAGGGTTGGTGG + Intergenic
1100392500 12:94156255-94156277 CTTGATATGCAGTTGGAAGGTGG + Intronic
1101468188 12:104969521-104969543 ACTGATAGGCAGTGTGTAGGTGG + Intergenic
1101889139 12:108696388-108696410 TGTGATATGAAGTGTGTCGGGGG + Intronic
1102439471 12:112950245-112950267 TGTGATATCCCGTGTGAAGGAGG + Intronic
1103137409 12:118519490-118519512 TGTGCCAGGCACTGGGTAGGGGG - Intergenic
1104820959 12:131677421-131677443 TGAGATAGCCAGTGGGTCGGGGG - Intergenic
1107418582 13:40223951-40223973 GGTGGTATGGAGTGGGGAGGGGG - Intergenic
1107778214 13:43870953-43870975 TTTGATATGAAGTGGGGAAGGGG - Intronic
1112742478 13:102490722-102490744 TGTCATATTTAGTGGGTTGGAGG + Intergenic
1113711572 13:112468728-112468750 AGTGATATGCAGTGTGATGGGGG - Intergenic
1113970447 13:114184996-114185018 TGTCAGTTGCAGTGGGTGGGGGG + Intergenic
1116306985 14:43268772-43268794 TTTGAGATGCATTTGGTAGGAGG + Intergenic
1119833968 14:77730330-77730352 TTTGCTAGACAGTGGGTAGGGGG - Intronic
1121311350 14:92936876-92936898 TGTGCTTTGCAGGGGGCAGGGGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1126103133 15:45131344-45131366 TGTGATATAGAGAGGGTAGGCGG - Intronic
1133649688 16:7800020-7800042 TCTGATATTTAGTGGGTCGGGGG - Intergenic
1133991375 16:10710170-10710192 TGTGATATTCAGTGGGTGAGAGG - Intergenic
1133992334 16:10717986-10718008 TGTAATATCCAGGGGGGAGGGGG - Intergenic
1134296396 16:12950015-12950037 TGTGACAAGTAGTGGGGAGGTGG - Intronic
1134817781 16:17220397-17220419 TGAGAGAAGCAGTGGGTAGCCGG + Intronic
1135966190 16:27037185-27037207 TGGGAGATGCAGGGGGAAGGAGG - Intergenic
1136716699 16:32288014-32288036 TGGGGAATGCAGTGGGTATGGGG + Intergenic
1136835076 16:33494259-33494281 TGGGGAATGCAGTGGGTATGGGG + Intergenic
1137716077 16:50599010-50599032 TGTGGTCAGCAGTGGGTGGGAGG + Intronic
1141278491 16:82608940-82608962 TGTGATGTGCAGTGGGGGAGAGG + Intergenic
1141385240 16:83616502-83616524 TGTGCTATGGAGTGGCTCGGTGG - Intronic
1141440747 16:84028230-84028252 GGTGGTAGGCAGTGGATAGGTGG + Intronic
1142200503 16:88759025-88759047 AGGGAAATGCCGTGGGTAGGGGG - Intronic
1142246933 16:88974493-88974515 TGTGCTGTGCAGGGGGTGGGAGG - Intronic
1203009727 16_KI270728v1_random:229773-229795 TGGGGAATGCAGTGGGTATGGGG - Intergenic
1203145248 16_KI270728v1_random:1794580-1794602 TGGGGAATGCAGTGGGTATGGGG + Intergenic
1144199179 17:12923940-12923962 GGAGAAATGCAGGGGGTAGGGGG - Intronic
1144789227 17:17848180-17848202 TGAGGAATGCAGTGGGGAGGGGG + Intronic
1147685708 17:42285806-42285828 TTTGAGATGCAGTGGGGAGGAGG - Intergenic
1154229447 18:12541306-12541328 TGTACTCTGCAGTGGGTGGGTGG + Intronic
1155778937 18:29805969-29805991 TGTTATACACAGTGGGTGGGTGG + Intergenic
1156284223 18:35675129-35675151 TGGGGTTTGAAGTGGGTAGGGGG - Intronic
1158620363 18:59027612-59027634 AGTGAAATGCAGTGGATAAGGGG - Intergenic
1161238237 19:3208402-3208424 GGGGATTTGCAGTGGGTCGGGGG - Exonic
1163058723 19:14742551-14742573 TGAGTTTTGCAGTGGGTAGAGGG + Intronic
1163298911 19:16430640-16430662 TGTGCTGGGCAGTGGGAAGGTGG - Intronic
1163491439 19:17619225-17619247 TGTGAGGGGCAGTGGGTTGGGGG + Intronic
927347165 2:22058347-22058369 TGTCATACGCAGTGGGTGAGTGG - Intergenic
927577628 2:24212653-24212675 TCTGATGAGCAGTGGGTAGCGGG + Exonic
929378455 2:41319650-41319672 TGTGCTATGCAGAGTGGAGGAGG + Intergenic
930013411 2:46955160-46955182 TGTGATAGGCAGTGAGGAGTAGG + Intronic
930101758 2:47608854-47608876 TGTGATCAGCAGTGGGTATAAGG + Intergenic
930697976 2:54430978-54431000 TGAGATTTGAAGTGGGTAGAGGG - Intergenic
932232106 2:70091281-70091303 TATAAGATGCAGTGGGGAGGAGG - Intergenic
934064392 2:88327106-88327128 TGTGTTCTGCAGTTGATAGGTGG - Intergenic
934113242 2:88761687-88761709 TTGGATATGGAGTGGGGAGGGGG - Intergenic
935015470 2:99177845-99177867 TGGGAAGGGCAGTGGGTAGGAGG - Intronic
940000569 2:148963039-148963061 GCTGACATGCAGTGGGTGGGTGG + Intronic
940712971 2:157184600-157184622 TGTGAGATGAAGTGGATAGAGGG - Intergenic
940922265 2:159321755-159321777 TGGGAACTGCAGTGGGGAGGTGG + Intronic
941366002 2:164612222-164612244 TGTTACATGCAGTGGTTAGGTGG - Intronic
942187773 2:173440621-173440643 TGTGAAGGGCAGGGGGTAGGGGG - Intergenic
942463349 2:176184877-176184899 AGGGATAGGGAGTGGGTAGGGGG + Intergenic
943788708 2:191908080-191908102 GGTGATATCCAGTAGGTAGTTGG - Intergenic
947969056 2:234306696-234306718 GGTGATTTGAAATGGGTAGGAGG - Intergenic
948012742 2:234662964-234662986 GGTGGGAGGCAGTGGGTAGGAGG - Intergenic
948381505 2:237553248-237553270 TCTGAGATGCAGTGGAAAGGGGG + Intronic
948960523 2:241332040-241332062 TGTGATATACAGTGTGAAGCAGG - Intronic
1170380723 20:15756909-15756931 TGTGACAGGCAGTGGGAATGAGG - Intronic
1172493146 20:35357762-35357784 TTTGTTTTGCAGTGGGTAGCAGG - Intronic
1172967824 20:38851107-38851129 TGTTATTTGCAGTTGGTATGTGG + Intronic
1173040326 20:39456156-39456178 TACAAAATGCAGTGGGTAGGTGG + Intergenic
1174169856 20:48609482-48609504 TGTGACATTGAGTGGGAAGGTGG + Intergenic
1174537906 20:51267024-51267046 TGTGATGCGCAGTGGAGAGGCGG + Intergenic
1174597553 20:51696188-51696210 TGTGCTGTGCGGTGGGGAGGGGG + Intronic
1174906543 20:54557806-54557828 TGTGGAAGGCAGTGAGTAGGTGG - Intronic
1178456257 21:32754797-32754819 TGGGACATGTTGTGGGTAGGGGG - Intronic
1179391166 21:40993044-40993066 TGTGGTATGCAGTGTGTGGGGGG - Intergenic
1179528763 21:42003286-42003308 TGTGATGTGTGGTGGGTAGCAGG - Intronic
1180972976 22:19825156-19825178 TGAGATATGCAGTGGGGCAGAGG - Intronic
1182063755 22:27416459-27416481 TGTGAGATGCCGTGTGGAGGGGG - Intergenic
955130771 3:56165466-56165488 TGCCATATGCAGGGGGGAGGGGG - Intronic
956250378 3:67229007-67229029 TGTGCTCCCCAGTGGGTAGGTGG + Intergenic
956402533 3:68895575-68895597 GGGGAGATACAGTGGGTAGGGGG + Intronic
956697801 3:71933455-71933477 TGTGCTGTGGAGTGGGTGGGAGG - Intergenic
958693941 3:97504319-97504341 AGAGCTCTGCAGTGGGTAGGGGG + Intronic
959770113 3:110084430-110084452 TAAGATATTCAGTGGTTAGGAGG + Intergenic
960451645 3:117817015-117817037 TGTGATATGTAATGAGTAGAGGG - Intergenic
961321208 3:126077877-126077899 TGTGATGTGCAGTGGGGACAGGG + Intronic
963701892 3:148637083-148637105 TGGGAAATGTAGTGGGAAGGTGG + Intergenic
964634267 3:158843283-158843305 GGTGAGAGGCATTGGGTAGGGGG + Intergenic
967606403 3:191452100-191452122 TGGGATCTGCTGTGGGAAGGAGG + Intergenic
969006672 4:4025765-4025787 TGACATATGCAGTGGGGTGGAGG + Intergenic
973261373 4:48167735-48167757 TGTGATATGCAGTGGGTAGGTGG - Intronic
974996833 4:69171163-69171185 AGTGATATGTGGTGTGTAGGTGG - Intronic
976364838 4:84221830-84221852 TGTGAAATGCAGAGGGAAGTGGG + Intergenic
977594973 4:98868559-98868581 TATGTTTTGCAGGGGGTAGGGGG - Intergenic
981106941 4:140892177-140892199 TTTGATATGCAGTTGGATGGAGG + Intronic
981629403 4:146801068-146801090 TGTGGTATGCTGAGGGCAGGGGG + Intronic
982479101 4:155887270-155887292 TGTGATAAGTAGAGGGTAGAGGG - Intronic
984859153 4:184220580-184220602 TGTGATGTTCAGTGTCTAGGAGG - Intronic
986840174 5:11687536-11687558 TGTGATATGGAGGAGGTAGCTGG + Intronic
988409236 5:30864912-30864934 TTTGATGTGCATTGAGTAGGAGG + Intergenic
988779520 5:34507374-34507396 TGTGATTTGCAGAGGATAGCAGG - Intergenic
989259059 5:39398827-39398849 TTTAACATGCAGTGGGTAGAAGG + Intronic
990342287 5:54835296-54835318 GATGAAATGCAGTGGGCAGGAGG - Intergenic
992938309 5:81735385-81735407 TGGTATCTGCAGTGGGTGGGGGG - Intronic
993118119 5:83741954-83741976 TGTGTTCTGCAGTGGCTAGAAGG + Intergenic
996470253 5:123852306-123852328 TGGGATCTCCTGTGGGTAGGAGG + Intergenic
997532201 5:134588466-134588488 AGAGATTTTCAGTGGGTAGGAGG + Intergenic
997686273 5:135789582-135789604 TGTAATATCCAGTGGGGAAGAGG + Intergenic
1000923842 5:167170036-167170058 TGAGTTCTTCAGTGGGTAGGTGG - Intergenic
1003864337 6:10349562-10349584 TGTGACTTGCACTGTGTAGGAGG + Intergenic
1004255378 6:14058573-14058595 AGTGATTTCCAGTGGCTAGGAGG + Intergenic
1005692902 6:28324201-28324223 TGTGAAGTGCAATGGGCAGGTGG - Intergenic
1007214413 6:40226243-40226265 AGTGATAAACAGGGGGTAGGGGG + Intergenic
1014588526 6:123231912-123231934 TGGGATATGGAGAGGGTAGAAGG + Intronic
1016124422 6:140382848-140382870 GGTGATATGAAGTGAGGAGGGGG - Intergenic
1016866359 6:148771577-148771599 GCTGAGATGGAGTGGGTAGGTGG + Intronic
1017453054 6:154572657-154572679 TGTGATATGCTGTGTTCAGGAGG + Intergenic
1018856847 6:167681025-167681047 TGTGATGTCCAGTGAGCAGGCGG - Intergenic
1019398035 7:834027-834049 TGGGAAATGCAGAGGGAAGGTGG + Intronic
1019947623 7:4342540-4342562 TGTGATTTGAAGTGTGTGGGAGG - Intergenic
1021000404 7:15323470-15323492 TGTCATATGGAGATGGTAGGAGG + Intronic
1021840428 7:24717774-24717796 AGTGATATGCACGGGGTAGGGGG - Intronic
1022336756 7:29429127-29429149 TGTGATATGCATAGGGCAAGAGG - Intronic
1024346074 7:48315153-48315175 TGTGAGATGCAATGGATATGAGG + Intronic
1029363526 7:100103028-100103050 TGTGGGATGCCGTGGTTAGGAGG + Intronic
1031291097 7:119936195-119936217 TGTAAAATGCAGAGGGTAGAAGG + Intergenic
1031388534 7:121183568-121183590 GGTAATAAGCAGTGGGTAAGTGG + Intronic
1034488537 7:151381016-151381038 TGTGAGAGGCAGAGGGCAGGAGG + Intronic
1035516808 8:240707-240729 AAGGACATGCAGTGGGTAGGGGG - Intronic
1036093216 8:5692226-5692248 TTTGATATTCAGTGTGTAAGTGG - Intergenic
1036369444 8:8150146-8150168 TGACATATGCAGTGGGGTGGAGG - Intergenic
1036500277 8:9307937-9307959 TGTAGTATGCAGTGGGGAGATGG + Intergenic
1036819985 8:11932619-11932641 TTTAATATCCAGTGGGCAGGAGG + Intergenic
1036881445 8:12515494-12515516 TGACATATGCAGTGGGGTGGAGG + Intergenic
1037408403 8:18568233-18568255 TGTGATATTTAGTGGCTGGGAGG - Intronic
1037660659 8:20923890-20923912 GGTGAAGTGCAGTTGGTAGGTGG - Intergenic
1037731233 8:21525496-21525518 TGGGTGATGCAGTGGGGAGGTGG - Intergenic
1037818293 8:22123531-22123553 GGGGCTGTGCAGTGGGTAGGGGG + Intronic
1039239373 8:35538534-35538556 TCTGCTTTGCAGTGTGTAGGAGG + Intronic
1039436491 8:37563021-37563043 TTTGATATGCAGTTGGTGGATGG - Intergenic
1040880892 8:52203175-52203197 TTTGACATGGAGGGGGTAGGGGG + Intronic
1044838972 8:96322125-96322147 TGTGATTTGCTGTGGTGAGGAGG - Intronic
1046228001 8:111311303-111311325 TGTAAGATGCAGTGGGAAGAGGG + Intergenic
1046829591 8:118729906-118729928 TGTGATAGGCAGTGGGCAAGTGG + Intergenic
1047723726 8:127666665-127666687 TGGGAGGTGGAGTGGGTAGGGGG - Intergenic
1049913143 9:289718-289740 TGTGATATGGAGTGGGGATAAGG - Intronic
1050143259 9:2538646-2538668 TGTTAGATGCTGTGGGGAGGTGG - Intergenic
1052824272 9:33163884-33163906 TGAGTGATGCAGTGGGAAGGGGG - Intronic
1052977070 9:34419211-34419233 TGTGGTGGGCAGTGGGGAGGAGG + Intronic
1056773453 9:89496109-89496131 TTTGATATCCAGTGGGTCTGGGG - Intronic
1056916987 9:90754795-90754817 TTTAATATCCAGTGGGTGGGAGG + Intergenic
1058633827 9:107017367-107017389 TGTGAGATGGAGTAGGGAGGGGG + Intergenic
1060764825 9:126286884-126286906 TGTATAATGCAGTGTGTAGGGGG + Intergenic
1062588964 9:137264422-137264444 TGTGTTTTGCCGTGGGTAGCAGG + Intronic
1185779177 X:2829974-2829996 GGTGACATGGAGTGGGTAGGAGG + Intronic
1187441416 X:19323979-19324001 TGTTATACGCAGTGGGGAGGAGG + Intergenic
1189128941 X:38478623-38478645 TGTGATGTTCAGTGAGTAGGAGG - Intronic
1189745555 X:44165396-44165418 GGTGGTAAACAGTGGGTAGGGGG - Intronic
1189782021 X:44524227-44524249 TGTGATATCCAGTGGATTTGTGG - Exonic
1189966101 X:46375519-46375541 TGTGATATGAAGAGTGTGGGAGG - Intergenic
1196986776 X:121282219-121282241 TGTGATAGGCAGTGGCAGGGTGG + Intergenic
1197786051 X:130198065-130198087 TGTGATATTCGGTGGCTGGGGGG - Intergenic
1201290869 Y:12420519-12420541 GGTGACATGGAGTGAGTAGGAGG - Intergenic