ID: 973268806

View in Genome Browser
Species Human (GRCh38)
Location 4:48238840-48238862
Sequence CAAGCTACTTCCCTGGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973268804_973268806 -5 Left 973268804 4:48238822-48238844 CCATTTTCAACTTAAAGACAAGC 0: 1
1: 0
2: 1
3: 16
4: 220
Right 973268806 4:48238840-48238862 CAAGCTACTTCCCTGGATTTAGG 0: 1
1: 0
2: 1
3: 16
4: 121
973268802_973268806 4 Left 973268802 4:48238813-48238835 CCTTCCAGGCCATTTTCAACTTA 0: 1
1: 1
2: 1
3: 18
4: 207
Right 973268806 4:48238840-48238862 CAAGCTACTTCCCTGGATTTAGG 0: 1
1: 0
2: 1
3: 16
4: 121
973268803_973268806 0 Left 973268803 4:48238817-48238839 CCAGGCCATTTTCAACTTAAAGA 0: 1
1: 0
2: 2
3: 21
4: 253
Right 973268806 4:48238840-48238862 CAAGCTACTTCCCTGGATTTAGG 0: 1
1: 0
2: 1
3: 16
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973268806 Original CRISPR CAAGCTACTTCCCTGGATTT AGG Intronic
903997707 1:27318069-27318091 CAGGCTCTTTCCCTGGATTGAGG + Intergenic
904018949 1:27447079-27447101 TAAGCTTCTTCCCTGCATTCTGG - Intronic
907229881 1:52986797-52986819 TAAGCAGCTTCCATGGATTTTGG - Intronic
912678370 1:111708402-111708424 CTAGTAACTTCCCTTGATTTGGG - Intronic
912983572 1:114402939-114402961 GAAGCTACTTCCCTGGACTGGGG + Intronic
917435545 1:175017364-175017386 TAAGCTACTTTCCTACATTTAGG - Intronic
918532321 1:185537383-185537405 CAAGCTCCATCCCTGGATCTTGG - Intergenic
918587406 1:186203719-186203741 TTAGCTATTTCCCTAGATTTTGG - Intergenic
921739239 1:218665134-218665156 GAAGCAACTTCCCTAGTTTTAGG - Intergenic
924140266 1:241014968-241014990 CACGCTATTTCCCTGTATCTAGG - Intronic
924215357 1:241815499-241815521 CAAGCTAATACCATTGATTTTGG - Intergenic
1063387978 10:5628348-5628370 CCAGCCTCTTCCCTTGATTTGGG - Intergenic
1066414162 10:35204040-35204062 TAACCTTCTTCCCTGGATGTGGG + Intronic
1066425768 10:35306456-35306478 CCAGCTCCTTCCCTGGCTTTCGG + Intronic
1067263666 10:44716767-44716789 CATGCTGCTACGCTGGATTTGGG + Intergenic
1069607422 10:69748513-69748535 CAAGCTGCTTCCCTGGTTATTGG + Intergenic
1072518053 10:96205836-96205858 CCTGCTTCTTTCCTGGATTTTGG + Intronic
1073726387 10:106236025-106236047 CATGCTACTTCCCTGAAGTTAGG - Intergenic
1074182407 10:111076626-111076648 GAGGTTACTTCCCTCGATTTGGG + Intergenic
1075846750 10:125551115-125551137 CAGCCTACTTCCCTCCATTTGGG + Intergenic
1080151100 11:29053077-29053099 TAAGCTCTCTCCCTGGATTTTGG + Intergenic
1082812039 11:57484318-57484340 CCCCCTACTTCCCAGGATTTGGG - Intergenic
1084482500 11:69430074-69430096 CAGGCTCCTTCCCAGGCTTTCGG + Intergenic
1092009466 12:5097478-5097500 CAAGCTGCTTGCCTGGGATTTGG - Intergenic
1106314260 13:28579340-28579362 CCAGCTACTTCCCTGGGTAAAGG + Intergenic
1111775375 13:92655038-92655060 CAGGCTTCTTCCCTAGTTTTTGG - Intronic
1114296717 14:21336038-21336060 CAATCTACCTCCTTGGTTTTAGG - Intronic
1115941904 14:38619069-38619091 CAAAAAACTTCCCTGGTTTTGGG + Intergenic
1122677305 14:103426419-103426441 CAAGCTCATTCCCTGGACTTTGG + Intronic
1124969132 15:34467743-34467765 CATGCTTCTTCCCTAGTTTTTGG - Intergenic
1125266464 15:37886963-37886985 CAAACTACTTCCCATGAGTTTGG + Intergenic
1127271250 15:57403835-57403857 CTGGCTTCTTCCCTGGATCTAGG + Intronic
1128031099 15:64480708-64480730 CATGCTACTTCCCTGGTTATAGG - Intronic
1128986007 15:72221985-72222007 CAAACTAGTTTGCTGGATTTGGG - Intronic
1130352023 15:83101310-83101332 CAGGAAACTTCCCTGGGTTTTGG - Intergenic
1131014075 15:89043115-89043137 CTAGCTACTCCCATGGTTTTGGG - Intergenic
1131183506 15:90256361-90256383 CCAGCTTCCTCCCTGGCTTTTGG - Intronic
1132190151 15:99847674-99847696 CATGCTTCTTCCCTAGATTTTGG + Intergenic
1140462882 16:75155244-75155266 CCAGCTACTTGCGGGGATTTAGG - Intronic
1147286149 17:39403593-39403615 GAAGCTAGGTCCCTGGTTTTAGG - Intergenic
1148207108 17:45785624-45785646 CAAGAGACTTCGGTGGATTTGGG + Intronic
1149051577 17:52311112-52311134 CATAGTACTCCCCTGGATTTGGG - Intergenic
1152193370 17:78902111-78902133 CAAGCCACTGCACTGGGTTTTGG + Intronic
1157713631 18:49867059-49867081 CAGCTTCCTTCCCTGGATTTTGG - Intronic
1162837098 19:13327382-13327404 CAAGCCACTGGCCTGGGTTTTGG + Intronic
1167772327 19:51529136-51529158 CATGCTCCTTCCCTGGCTTCTGG - Intronic
926424085 2:12725570-12725592 GAAGCTTCTTCCCTGGATCCTGG - Intronic
927306634 2:21581133-21581155 CAAGTTATTTCAATGGATTTGGG + Intergenic
927935939 2:27076716-27076738 CAATCTACCTCTCTGAATTTCGG + Intergenic
929905131 2:46039102-46039124 CAATCTACTTCTCTGTGTTTCGG + Intronic
930301222 2:49618475-49618497 CAAGGTGCTTTCCTGGATCTGGG - Intergenic
930383124 2:50657229-50657251 CCAGACAGTTCCCTGGATTTTGG + Intronic
933913753 2:86967611-86967633 CAAGCTAATGTCCTGGTTTTAGG - Intronic
934009240 2:87802287-87802309 CAAGCTAATGTCCTGGTTTTAGG + Intronic
934567297 2:95347738-95347760 AAAGCTACATCCCTGGCTTCAGG - Intronic
935772824 2:106442997-106443019 CAAGCTAATGTCCTGGCTTTAGG + Intronic
935907245 2:107852932-107852954 CAAGCTAATGTCCTGGCTTTAGG - Intronic
936129036 2:109818073-109818095 CAAGCTAATGTCCTGGTTTTAGG - Intronic
936215661 2:110553412-110553434 CAAGCTAATGTCCTGGTTTTAGG + Intronic
936424798 2:112407985-112408007 CAAGCTAATGTCCTGGTTTTAGG + Intronic
937387221 2:121446565-121446587 CCAGCTAAGTCCCTAGATTTTGG + Intronic
941505969 2:166345939-166345961 CTAGCTTCCTCCCTGAATTTGGG + Intronic
941958579 2:171230418-171230440 TCAGCTATTTCCCTGGAATTCGG - Intronic
943467098 2:188241125-188241147 CCAGCTATTTCACTGGAATTTGG + Intergenic
944284823 2:197937588-197937610 CCAGCTACTTCTGTTGATTTGGG + Intronic
944663384 2:201939577-201939599 CAAGCTTCCTTCCTGGATCTTGG + Intergenic
945294359 2:208156068-208156090 CCAGCCACTTCCTTGTATTTTGG + Intergenic
948652644 2:239458013-239458035 CATGGAACTTCCCTGGACTTTGG + Intergenic
1173683716 20:44907979-44908001 CACGCAACTTCCCTGAATATAGG - Exonic
1175453361 20:59089756-59089778 CAAGCCACTTCCCCGGAGCTTGG - Intergenic
1176155798 20:63619750-63619772 CAAGCAACTTCCCTGGACGCAGG + Exonic
1177020885 21:15856093-15856115 CCAGCTACATCCCTGGATTTAGG - Intronic
1177955633 21:27595100-27595122 CATGCTACTGCCCTGTATTTGGG + Intergenic
1178304157 21:31476771-31476793 CATTCTACTGCCCTGGGTTTTGG - Intronic
1184733010 22:46381353-46381375 CCAGATACTTCCCTGGCTCTGGG - Intronic
949563921 3:5228056-5228078 CTAGCTTCTACCCTGGATGTTGG + Intergenic
952564363 3:34637085-34637107 AAACATAATTCCCTGGATTTTGG + Intergenic
953933245 3:47017619-47017641 CAAGGTACTCCCCTTGCTTTTGG - Exonic
956333433 3:68136737-68136759 CATCCTACTTCCATGGATATGGG + Intronic
960421192 3:117447549-117447571 CAAGCAACTTCTCTGGCTTAAGG + Intergenic
960520785 3:118652954-118652976 CAACCTATTTCCCTGGATGTTGG + Intergenic
962837955 3:139205444-139205466 GCAGCTACTTCCCTGAATTGAGG + Intronic
963183525 3:142387359-142387381 CAAGGGACTTCCTTGGATTATGG + Intronic
965193298 3:165559839-165559861 CAAGCTATTTCCTTTGATTAAGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967451183 3:189625155-189625177 TAAGGTACTTCCCTGGACCTTGG + Intergenic
968608958 4:1548396-1548418 CAAGCTGCTTCCCTGGACTCTGG - Intergenic
973268806 4:48238840-48238862 CAAGCTACTTCCCTGGATTTAGG + Intronic
973795114 4:54417266-54417288 CAGGTTACTTCACTGCATTTAGG + Intergenic
974886235 4:67821060-67821082 CAAGCTAACTCCCTGCATCTGGG - Exonic
975241816 4:72068073-72068095 AAATCTACTTCCCTATATTTTGG + Intronic
976178664 4:82379004-82379026 AAAGATGATTCCCTGGATTTTGG - Intergenic
977999196 4:103535964-103535986 CAATTTATTTACCTGGATTTTGG + Intergenic
979570174 4:122213645-122213667 CTAGTTTCTTCCATGGATTTTGG - Intronic
982742715 4:159074506-159074528 CAAGCCACTTCCCTCCAATTTGG + Intergenic
984966100 4:185141936-185141958 CATTCTGCTTACCTGGATTTCGG + Intergenic
990003925 5:50923443-50923465 CAAGCTGCTTCCCTGGACTCTGG + Intergenic
990486522 5:56264554-56264576 CACCGTACTTCCCTGGAATTTGG + Intergenic
990527556 5:56642919-56642941 GAAGCTACTTCATTGGAGTTAGG + Intergenic
990675142 5:58175886-58175908 CAGGCTTCTCCCCTAGATTTTGG + Intergenic
991384361 5:66068763-66068785 CATGATACTTCTCTGGTTTTGGG + Intronic
992053989 5:72969300-72969322 CCAGCTACTTGTCTGGATTATGG + Intronic
992636706 5:78731544-78731566 CAAGCCTCTTCCCTGGCTTGTGG + Intronic
997053993 5:130418528-130418550 CCAGCTTCTTCCCTGGTTTCTGG - Intergenic
998376892 5:141696983-141697005 CAAGCTGTTTCTCTGGGTTTTGG - Intergenic
999839654 5:155411559-155411581 CAAGCTACTACCTTGGATCTGGG + Intergenic
1005812067 6:29524968-29524990 CAAGCGACTAACCTGCATTTTGG + Intergenic
1006834173 6:36986517-36986539 CAAGCCACCTCCCTGGCTTCGGG + Intergenic
1007062343 6:38953166-38953188 TGAGTTACTTCCCTGGATATTGG - Intronic
1007592963 6:43034428-43034450 AAAGCTTCTCACCTGGATTTGGG + Intergenic
1009207481 6:60820312-60820334 CAAGCTAATTTTCTGGATATAGG - Intergenic
1009665579 6:66673717-66673739 CTAGCTACTTGCCTATATTTTGG + Intergenic
1012479135 6:99648941-99648963 TAGGTTACTTTCCTGGATTTTGG + Intergenic
1013764629 6:113560552-113560574 CATGCCACTTCCCTGGCTTCTGG + Intergenic
1014813181 6:125907565-125907587 CCAACTACTTCCTTGGCTTTAGG - Intronic
1015336006 6:132039691-132039713 CAAGGTACTTCCCTTTATGTCGG + Intergenic
1017657193 6:156641152-156641174 TAAGCTACTTCTCTGTATTTTGG - Intergenic
1020737110 7:11964612-11964634 TTAGCTAATTCCCTGGATGTTGG + Intergenic
1020967171 7:14885699-14885721 TAAGATAATTCCATGGATTTAGG + Intronic
1024217545 7:47260218-47260240 CATACTCCTTCCCTGGCTTTAGG + Intergenic
1026353497 7:69537674-69537696 CTAGCTACTTCAGTGAATTTGGG + Intergenic
1026494978 7:70894235-70894257 CCAGCCACTTCCGTGGACTTCGG - Intergenic
1027156477 7:75771938-75771960 CAAGCCCCTTCCCTGGACCTGGG - Exonic
1028266643 7:88733949-88733971 TGAGCTACTTCCCTGGGGTTAGG + Intergenic
1029000324 7:97147470-97147492 TAAACTAGTTCCCTAGATTTTGG - Intronic
1029559059 7:101290398-101290420 GAAGCTACTGCCTTGGATATCGG + Intergenic
1030769945 7:113462416-113462438 CAAGGTAGTTCCCAGGATTTAGG - Intergenic
1037290193 8:17342261-17342283 CAAAGTACTTTCATGGATTTAGG + Intronic
1037435687 8:18860976-18860998 CAAAGTAATTCCCTGGATATTGG - Intronic
1052249780 9:26384238-26384260 CAGGCTCCTTCCCTGTCTTTGGG - Intergenic
1058597726 9:106632796-106632818 CAAGGTATGTCCCTGGACTTTGG - Intergenic
1058733140 9:107869304-107869326 CAAGCTAGTGCCCAGGTTTTAGG + Intergenic
1059958384 9:119541944-119541966 GAAGCTCCTTCCATGGATTTTGG + Intergenic
1061712766 9:132499141-132499163 CAAGCATCTTCCCTGGAGCTGGG - Intronic
1062183461 9:135203389-135203411 CAAGCTGCTGGGCTGGATTTGGG + Intergenic
1186194905 X:7100178-7100200 CAAGCTGATTCCCTGGTTATTGG + Intronic
1190055270 X:47177915-47177937 CAAGAGAATTCCCTGGTTTTGGG - Intronic
1191764848 X:64686654-64686676 CAAACTGCTTCCCTGTGTTTTGG - Intergenic
1196565605 X:117200960-117200982 CAAGCTACTAACCTGCTTTTTGG - Intergenic