ID: 973271536

View in Genome Browser
Species Human (GRCh38)
Location 4:48267852-48267874
Sequence GAGCTGGAACAGCTGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 2, 1: 1, 2: 7, 3: 73, 4: 484}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973271536 Original CRISPR GAGCTGGAACAGCTGGGGCA GGG Intronic
900097204 1:944740-944762 GAGCTGCAGCAGCTGGCCCAGGG - Exonic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900915294 1:5633392-5633414 CCGCTGGAAAAGCTGGGGGAAGG - Intergenic
901142200 1:7042440-7042462 GCCCTGGAGCAGCTGGAGCAGGG + Intronic
901202241 1:7473337-7473359 TAGGAGGAACAGCTGGGGCTGGG + Intronic
901751756 1:11414314-11414336 CAGCTGGAGCAGGTGGGGGAGGG + Intergenic
902249830 1:15147017-15147039 GAGCTGGCAAAGCTGGGGTCTGG - Intergenic
902287237 1:15414443-15414465 ACGCTGGAACAGCGGGGACAGGG + Intronic
902675124 1:18003346-18003368 GAGCTGGAAAGGTTGGGGCGGGG + Intergenic
902742153 1:18446092-18446114 GTGCTGGAACAGAAGGTGCAAGG - Intergenic
903354383 1:22737215-22737237 GAGATGGTCCAGGTGGGGCAGGG - Intronic
903831412 1:26177529-26177551 GAGCTGGCAGAGCTGGGCCATGG + Exonic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904334927 1:29790771-29790793 TATCTGGAACAGATGGGGAAAGG - Intergenic
905274006 1:36805488-36805510 GAGCTGCATCAGCAGGGGCAGGG + Intronic
906645207 1:47469887-47469909 GTGCTGGAACACGTTGGGCAAGG + Intergenic
906838060 1:49105399-49105421 CAGCTGTAACAGGTGGGGCATGG - Intronic
906961313 1:50420985-50421007 GAGGCGGAGCAGCTGGCGCAGGG - Exonic
907267108 1:53269148-53269170 AAGCTGGTACAGTTGGAGCAAGG - Intronic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
911554579 1:99328315-99328337 GACCTAGAACACCTGGGGAAAGG - Intergenic
912390154 1:109297325-109297347 GAGCTGGGGAAGCTGCGGCAAGG - Intronic
912955233 1:114151120-114151142 GAGGCGGAACAGCTGGGGCCTGG + Intronic
914490623 1:148148432-148148454 GTGCTGGATCAGCTGGGTCAGGG + Intronic
915488590 1:156239132-156239154 TAGCTGGAATGGGTGGGGCATGG - Intronic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
915725145 1:158011903-158011925 GAGGGGGAAGAGCTGGGGGAGGG - Intronic
916497024 1:165355865-165355887 GGGATGGAAAACCTGGGGCAAGG - Intronic
916632388 1:166630579-166630601 GAGTTGAAGCATCTGGGGCAAGG + Intergenic
917052328 1:170938439-170938461 TACCTGGAAGGGCTGGGGCAAGG - Intronic
917471374 1:175328742-175328764 GAGCTGGAACAGAGGGAGCAAGG + Intronic
917670992 1:177273405-177273427 GAGATGGAGCAGCTGGAGAAGGG + Intronic
918250610 1:182699854-182699876 GAGCTGGCACTGCTGGAACACGG - Intergenic
919497132 1:198286922-198286944 GAGATGCAACAGAAGGGGCAGGG - Intronic
921060888 1:211583575-211583597 GAGCTGGAACTTCTGTGGAAGGG + Intergenic
921342635 1:214149614-214149636 GAGCTGGAACAAGTTGAGCAAGG + Intergenic
921389911 1:214606784-214606806 GTGCTGGATCAGCTGGGTCACGG - Intronic
921531236 1:216285271-216285293 TAGCTGGAGCAGTTGGGACACGG - Intronic
923645228 1:235813805-235813827 GACCTGGGACACCTGGGACATGG + Intronic
924413373 1:243831057-243831079 GAACTGGGACAGCTGAGGCAAGG - Intronic
1063009912 10:2011912-2011934 GAGCAGGAAGAACTTGGGCAGGG - Intergenic
1063636595 10:7788300-7788322 GGGATGGAAGAGCTTGGGCACGG + Intronic
1064151186 10:12866522-12866544 GAGGTGGAATTGCTGGGTCAAGG - Intergenic
1064575021 10:16736085-16736107 GAGCTGGAATTTGTGGGGCAAGG + Intronic
1066006759 10:31153007-31153029 GAGCTGGGTCAACTGGGGCTAGG + Intergenic
1066453601 10:35553311-35553333 GAGCTGTTACAACAGGGGCATGG + Intronic
1067291958 10:44950175-44950197 GAGGTGGCACGGCTGGGGCCTGG - Intergenic
1067419692 10:46134813-46134835 TAGCTGGACCAGCTGGGCCAGGG - Intergenic
1067426326 10:46214598-46214620 TAGCTGGACCAGCTGGGCCAGGG + Intergenic
1067505043 10:46841410-46841432 TAGCTGGACCAGCTGGGCCAGGG - Intergenic
1067563855 10:47322694-47322716 CAGCAGGGACAGCAGGGGCAGGG - Exonic
1067948073 10:50703585-50703607 GAGCTGGAACTGTTAGGGAAAGG - Intergenic
1068222821 10:54064766-54064788 GAGCTGGAAGAGGTCAGGCAGGG + Intronic
1068243538 10:54336478-54336500 TGGCTGGAGCAGCTGGGACACGG - Intronic
1069112528 10:64464785-64464807 GAGCTGAAGCAACTGGGGCAGGG + Intergenic
1069799811 10:71075110-71075132 GAGGTGGCAGAGCTGGGGCCGGG + Intergenic
1070581590 10:77724611-77724633 GAGCTGGAGCAGCTGGGATGTGG - Intergenic
1070661651 10:78310821-78310843 TGGCTGGAACAGCTGGGGTCTGG + Intergenic
1070680495 10:78445714-78445736 GTGCTGGAGCAGGTGGGGAAGGG - Intergenic
1070830973 10:79417941-79417963 GAGGTGGCCCAGCTGGGGCAAGG - Intronic
1070883385 10:79868583-79868605 GAGCTGGAACTGTTAGGGAAAGG - Intergenic
1071038474 10:81277306-81277328 AAGCTGTCACAACTGGGGCATGG - Intergenic
1071474873 10:86017554-86017576 GAGCAGGCACAACTGGGTCATGG + Intronic
1071666914 10:87567713-87567735 GAGCTGGAGCAGCTGGGATGTGG - Intergenic
1072188297 10:93061964-93061986 GAGCTGGAACTTCTGGGCCTGGG - Intronic
1073006639 10:100330051-100330073 GAGCTGCAAAAGCTGGGGAGTGG - Exonic
1073442423 10:103560262-103560284 GGGCTGGAAGGACTGGGGCAGGG + Intronic
1074286279 10:112100895-112100917 CAGCTGGAGCAGCTGGGACATGG + Intergenic
1074619594 10:115105649-115105671 TAGCTAGAGCAGCTGGGACAAGG - Intronic
1074943708 10:118259915-118259937 GAGCTGGAGCAGCTCTGGGAGGG + Intergenic
1076020114 10:127065677-127065699 GAGCTGGAGGAGCTGCGGAAAGG - Intronic
1076537955 10:131195064-131195086 GACCTGGAACAGCCTGGGCCAGG - Intronic
1076682509 10:132180461-132180483 GAGACGGAACAGATGGGGTAGGG + Intronic
1077337214 11:2010767-2010789 GGGCTGGAAAGGCCGGGGCAAGG + Intergenic
1077371096 11:2181994-2182016 GAGATGGAGCAGGTGGGGCAGGG + Intergenic
1077817323 11:5698396-5698418 GAGCTGCAAAAGCTGGAGGAAGG + Exonic
1078102796 11:8339686-8339708 GGGCTGCAAGAGCTAGGGCAAGG + Intergenic
1078388904 11:10917917-10917939 GAGCTGGAGCAGCTGGGATGTGG + Intergenic
1079331469 11:19536427-19536449 GAGCTGGTACAGCTGGTCCCTGG - Intronic
1079801270 11:24872424-24872446 GAGCTGCTACAGCCAGGGCAGGG - Intronic
1080230800 11:30016637-30016659 AAGCTGCAACAGCTGGAGGAGGG + Exonic
1080304983 11:30826297-30826319 AAGCTGGAATAGCTAAGGCAGGG - Intergenic
1080736293 11:35017978-35018000 GTCCTGGAAGAGCTGGGTCATGG - Intronic
1081625570 11:44653343-44653365 GTGCTGGAAAAGCAGTGGCAAGG - Intergenic
1082665103 11:55966367-55966389 CAGCTGAATCAGCTGAGGCAAGG + Intergenic
1082834080 11:57639462-57639484 TAGCTGGAGCAGCAGGGGCAGGG - Intergenic
1083241553 11:61392502-61392524 GAGCTGGACGAGCTCGGGCCTGG - Exonic
1083393782 11:62374372-62374394 GAGAGGCAACAGCTGGGGCTGGG + Intronic
1083572632 11:63768577-63768599 GAGCCGGAGCAGCGGCGGCAGGG - Exonic
1083735410 11:64677517-64677539 GGGCAGGGACAGGTGGGGCAAGG - Intronic
1083742339 11:64717485-64717507 GAGCTGGAGTGGGTGGGGCAGGG + Intronic
1083766624 11:64844529-64844551 GCGCTGGAGCAGCTGGCGCGGGG - Exonic
1084270280 11:68025845-68025867 GTGATGGTACAGGTGGGGCAGGG - Intronic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084889742 11:72230806-72230828 GAGCTGCAACAGCTGGCAGAAGG - Exonic
1084931457 11:72559843-72559865 AAGCTGGAACACCCAGGGCAGGG + Intergenic
1084964711 11:72738600-72738622 GTGCTGGGACAGCTGGGCCCAGG - Intronic
1085014939 11:73167740-73167762 GAGCTGGACCTGCTGCTGCAGGG + Intergenic
1085299814 11:75451279-75451301 GAGCTGGAAGGGCTGTGACATGG + Intronic
1085303222 11:75470963-75470985 GAGCTGGAACCACTGGGGAGAGG - Intronic
1085331135 11:75652368-75652390 CAGAAGGGACAGCTGGGGCATGG - Intronic
1086059997 11:82690736-82690758 GAACCGGAACAGCTGCTGCAGGG + Intergenic
1086290144 11:85299437-85299459 GAGCTGGAACTGCTGAGTCATGG - Intronic
1087299425 11:96414387-96414409 GAGCTGCTAGAGCTGGGGGAAGG - Intronic
1089213023 11:116819266-116819288 GAGCGAGAGCAGCTGGGGCAGGG + Intergenic
1089566126 11:119372726-119372748 GAGCTGGAGCGGCTGGGCCCAGG + Exonic
1090208299 11:124897733-124897755 GAGCAGGAGCAGCAGAGGCAGGG + Exonic
1091316463 11:134617483-134617505 AAGCTGGAGCAGCTGGGACGTGG - Intergenic
1202820198 11_KI270721v1_random:65949-65971 GGGCTGGAAAGGCCGGGGCAAGG + Intergenic
1091386959 12:101909-101931 GAGGTGGGACAGCTGGGCTAGGG - Intronic
1091793382 12:3283997-3284019 GAGCTGGAAATGCCAGGGCAGGG + Exonic
1092006050 12:5071329-5071351 GAGCTGGGGCAGATTGGGCAGGG + Intergenic
1092168230 12:6356135-6356157 GAGCTCAAACAGCTGGCCCAAGG + Intronic
1092247793 12:6873134-6873156 GACCTGGATCAGATGGGGCGAGG - Intronic
1092923793 12:13256274-13256296 GACCAGGAGCAGCTGGGGCCTGG + Intergenic
1093087780 12:14885927-14885949 GAGCTGGAGAAGGTGGGGAAGGG + Intronic
1094241885 12:28237591-28237613 AAGCTGGAACAGGCAGGGCATGG + Intronic
1094399699 12:30049017-30049039 GAGCAGAAGGAGCTGGGGCAGGG - Intergenic
1094760878 12:33531306-33531328 TGGCTGGAACAGCGGAGGCAAGG - Intergenic
1096111754 12:49033168-49033190 CAGCTGGCACAGCAGGGTCAGGG - Exonic
1096192908 12:49631797-49631819 GGGCTGGAACAGGAGGGACAGGG - Intronic
1096230584 12:49894664-49894686 GAGCAGGACAAGCTGGGGAAAGG - Intronic
1097221894 12:57455931-57455953 GAGAAGGAGGAGCTGGGGCAGGG + Intronic
1098109572 12:67107921-67107943 TAGCTGCAACAGCTGGGATAGGG - Intergenic
1098174233 12:67774347-67774369 GAGGTGGAAAAGCTGGGGGTGGG + Intergenic
1098404397 12:70108759-70108781 GAGCTGCAGCTGCTGGGGCTGGG + Intergenic
1098800959 12:74957406-74957428 GAGCTGGGCTAGCAGGGGCAGGG - Intergenic
1099237187 12:80095626-80095648 GACCAGGAACAGATGGGGAAGGG + Intergenic
1099658664 12:85527557-85527579 GAGCTGGAGCAGCTGGGATGTGG - Intergenic
1101243595 12:102863065-102863087 GAGCTGATACAGCTAGGGAATGG - Intronic
1101755517 12:107618095-107618117 GAAGTGGATCTGCTGGGGCAGGG - Intronic
1102454877 12:113065185-113065207 GAGCTGGAGCAGGTGGGGCAGGG + Intronic
1103120652 12:118376868-118376890 GAGGTGGGACCGCTGGGGGAGGG + Intronic
1103938297 12:124488299-124488321 AAGCTGGAAAAGCTGGGGAAAGG + Intronic
1104644390 12:130486584-130486606 GAGATGGCACAGCTTGGGGAGGG - Intronic
1104963974 12:132500877-132500899 GAGCAGCAGCAACTGGGGCAGGG - Intronic
1104978339 12:132561940-132561962 GTGCTGGCACTGCTGGGGGATGG + Intronic
1105211934 13:18262022-18262044 GAGCTGGCACACCAGCGGCATGG - Intergenic
1106643743 13:31611345-31611367 GAGGAGGAACAGATGGGTCAAGG + Intergenic
1106770566 13:32957496-32957518 CAGCTGGCCCAGCTGGGGCTGGG + Intergenic
1107820697 13:44282856-44282878 GAACTGGAAGAGCTGCGGAATGG - Intergenic
1107963763 13:45580957-45580979 TAGCTGGAAGGGCTGAGGCAGGG + Intronic
1108121215 13:47189426-47189448 AAGTTGGGAGAGCTGGGGCAAGG + Intergenic
1108770945 13:53699932-53699954 GAGCTGGGATGGCTGGGACATGG - Intergenic
1111798138 13:92949550-92949572 GAGCTGGGACAGCTGGGGCCAGG - Intergenic
1112805168 13:103156789-103156811 GTGCAGGCAAAGCTGGGGCAGGG - Intergenic
1113741826 13:112716519-112716541 GAGCCGGGACAGAGGGGGCAAGG + Intronic
1117262544 14:54050978-54051000 GAGGTGGGAAAGCTGGCGCAAGG + Intergenic
1117343378 14:54810053-54810075 GAGCTGGAAGAGGTGGCCCAGGG + Intergenic
1118366796 14:65102871-65102893 GAGCTGGAACTCCTGGAGCCGGG + Intergenic
1118729461 14:68656245-68656267 TAGCTGGACAATCTGGGGCAGGG + Intronic
1118847691 14:69560097-69560119 GAGCTGGCACAGATGGGTCAAGG - Intergenic
1119266486 14:73265639-73265661 GAGATGGAGCAGCTGGGCAAAGG + Intronic
1119526060 14:75323393-75323415 GAGCCAGGACAGCTGGAGCAGGG - Intergenic
1119622372 14:76140872-76140894 TGGCTGGAACAACTGGGGTAAGG - Intergenic
1122227234 14:100286843-100286865 CAGCAGGATCAGCTGGGGCCAGG - Intergenic
1122940519 14:104978994-104979016 GACCTGGAGCCCCTGGGGCAGGG - Intergenic
1122965062 14:105119621-105119643 GATGTGGAACCGCAGGGGCAGGG + Intergenic
1124291346 15:28456066-28456088 GTGCTGGACCAGCTGGGCCAGGG - Intergenic
1124596070 15:31092198-31092220 GAGTGGGAACAGCAGGGGCAAGG + Intronic
1125275073 15:37980293-37980315 GAGCTGCAATAGCTGGTGCCAGG + Intergenic
1125384625 15:39124153-39124175 GAGATGGCAGAGCTGGAGCATGG + Intergenic
1125510707 15:40291070-40291092 GAGCTGGAGCTGCTGCGGCAGGG - Exonic
1127262268 15:57335063-57335085 GAGCTGGAACAGCAGGTGTGAGG + Intergenic
1128323835 15:66710446-66710468 GAGCTGGAAAAGCCGGGGTGGGG + Intronic
1128340789 15:66821320-66821342 GGGCTGGGACAGCTGGAGGAAGG + Intergenic
1128559956 15:68658254-68658276 GAGAGGGAACAGCTGGGGCCAGG + Intronic
1129157630 15:73728663-73728685 GAGGTGAAATAGCTGGTGCAAGG + Intergenic
1129296598 15:74603468-74603490 GAGCTGGAGGAGCTGAGACAGGG - Intronic
1129328257 15:74813219-74813241 GAGGAGAAACAGCTTGGGCAGGG - Intronic
1129679387 15:77649629-77649651 GAGCTGGGTCAGCTGGGGCTAGG + Intronic
1129740771 15:77988601-77988623 GATGTGTAACAGCTGAGGCAGGG - Intronic
1129812809 15:78524372-78524394 GAGCTGGCACAACTGGGACGTGG + Intronic
1129877585 15:78986223-78986245 GATCTGGAGCAGCTGGGGATGGG + Intronic
1129940691 15:79494513-79494535 GAGCTTGCACAGCTGGGGAGTGG + Intergenic
1130768918 15:86904187-86904209 GAGCTGGAACAGCTGAGAGCTGG - Intronic
1130865308 15:87928631-87928653 GGGCTGGAACAGATGAGGAAAGG - Intronic
1130990067 15:88870925-88870947 AAGCTGGTAGCGCTGGGGCATGG - Intronic
1132481680 16:169405-169427 GATCAGGAAGTGCTGGGGCAGGG - Intergenic
1132743171 16:1426086-1426108 GGGGTAGAACAGGTGGGGCAGGG - Intergenic
1132806510 16:1777539-1777561 CAGCTGGCACAGCTGAGGCAAGG + Intronic
1134236146 16:12468044-12468066 AGGCTGGGGCAGCTGGGGCAGGG - Intronic
1134369489 16:13609760-13609782 GAGCAGGAGCAGATGGGGGAAGG + Intergenic
1134822694 16:17259293-17259315 AAGCTGGAACAGCAGGAGAAAGG - Exonic
1135901315 16:26462446-26462468 GAGCTGCAAAACCTTGGGCAAGG + Intergenic
1136655182 16:31705409-31705431 GAGCTGCATCAGCTGGGTCCAGG - Intergenic
1136707432 16:32201605-32201627 GTGCTGGATCAGCTGGGCCAGGG + Intergenic
1136760479 16:32727812-32727834 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1136807624 16:33142574-33142596 GTGCTGGGTCAGCTGGGCCAGGG + Intergenic
1137273708 16:46919576-46919598 GAGCTGGAAAGGAGGGGGCACGG + Intronic
1138121855 16:54406594-54406616 GAGGTGGAATTGCTGGGTCAAGG - Intergenic
1138201070 16:55088867-55088889 GAGTTAGACCACCTGGGGCAAGG + Intergenic
1138554656 16:57764478-57764500 GAGCAGGAGGAGCTGGGGGAAGG - Intronic
1138613733 16:58147828-58147850 GAGCAGGACCAGCCAGGGCAGGG - Intergenic
1139559391 16:67732110-67732132 GAGCTGGAACTGCTGAGGGCAGG - Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1139738113 16:69010556-69010578 GAGCTGTGACAGCAGAGGCAAGG - Intronic
1140354292 16:74291847-74291869 TGGCTGGAATAGCTGGGGAATGG + Intergenic
1140726802 16:77820909-77820931 GGGCAGGGACTGCTGGGGCAGGG - Intronic
1140821858 16:78670175-78670197 GAGCTGGACCTGCTGGTGAAAGG - Intronic
1141705468 16:85662156-85662178 GAGCTGCAGCAGGTGGGTCAGGG + Intronic
1141865764 16:86748796-86748818 GAGCTGGGGTAACTGGGGCAGGG - Intergenic
1142111149 16:88332404-88332426 GAGCCGGCACAGAGGGGGCAGGG - Intergenic
1142154400 16:88526648-88526670 GAGCTGGCAGAGGTGTGGCATGG - Intronic
1203062632 16_KI270728v1_random:988127-988149 GTGCTGGGTCAGCTGGGCCAGGG - Intergenic
1142742292 17:1938093-1938115 GAGCTGGAGCAGGTGGGGCTGGG - Intronic
1143082788 17:4394095-4394117 GAGCTGGAACCGATGGGGAGTGG + Intergenic
1143904196 17:10196864-10196886 GAACTGGAAAAGCCAGGGCAGGG + Intronic
1144198159 17:12915739-12915761 GAGCTGGAACAGGTTGGCCCAGG + Intronic
1144578342 17:16443774-16443796 GAGCAGGAAGGGCTGGGGCAAGG + Exonic
1144733366 17:17541318-17541340 GAGCTGAAAGAGCTGGGGCTCGG - Intronic
1144751824 17:17653995-17654017 GAGCTGGAGCAGCTGGGGTGTGG + Intergenic
1144886848 17:18468967-18468989 GAGCAGGAACTGCAGGGGCTGGG - Intergenic
1145061518 17:19737228-19737250 GAGCAGGCACAGGTGGGGCCAGG + Intergenic
1145145367 17:20475329-20475351 GAGCAGGAACTGCAGGGGCTGGG + Intergenic
1145191207 17:20843034-20843056 GTGCTGGATCAGCTGGGTCAGGG + Intronic
1146353583 17:32116064-32116086 GAGCAGGAACTGCAGGGGCTGGG - Intergenic
1147374487 17:40015763-40015785 GAGCAGGAAGCTCTGGGGCAGGG - Exonic
1147585437 17:41651632-41651654 GAGCTGGGACAGCTGGGCGAAGG + Intergenic
1148440052 17:47707354-47707376 GAGCTGGAACAGACTTGGCAAGG - Intronic
1148483971 17:47978661-47978683 GAGCTGAGACACCTGGGACAAGG + Intronic
1148736967 17:49870299-49870321 GAGCTGGACAGGCTGGGGGAGGG + Intergenic
1148835680 17:50464604-50464626 GGGCTGGCAGAGTTGGGGCATGG + Exonic
1149454562 17:56777403-56777425 GAGCTTGCAGAGATGGGGCAGGG - Intergenic
1149626296 17:58083202-58083224 GAGCTGGAGCGGGTGGGGGAGGG - Intergenic
1149647675 17:58252127-58252149 GGGGTGGAACAGCTGGGTCCTGG - Intronic
1151962782 17:77415893-77415915 GAGCAGGGCCGGCTGGGGCAAGG + Intronic
1151974377 17:77476075-77476097 GAGATGGTGCCGCTGGGGCAAGG - Intronic
1152331814 17:79677841-79677863 GGGTTGGCAGAGCTGGGGCAGGG + Intergenic
1152628395 17:81398829-81398851 GAGCTGGTCCCGCTGGGGCTGGG + Intronic
1152757199 17:82091968-82091990 GAGATGCAACATCTGGGCCAAGG - Intronic
1152867147 17:82730979-82731001 CAGCTGGAAGAGATGGGGGAGGG + Intergenic
1154199328 18:12288242-12288264 CAGCTGAGACAGCTGGGGCGGGG + Intergenic
1154272591 18:12932876-12932898 AAGCAGCAACAGTTGGGGCAGGG - Intergenic
1155793980 18:30010593-30010615 GAACTGGAAAATCTGAGGCAAGG - Intergenic
1156463296 18:37333653-37333675 GAGAGGGCAGAGCTGGGGCAGGG - Intronic
1156635846 18:39028739-39028761 GAGCTGGAATAGGTGGGGGTGGG - Intergenic
1156910810 18:42409139-42409161 GAGCTGGAGCAGCTGGGACATGG + Intergenic
1158004221 18:52653724-52653746 GACCTGGAACAACTGGCGGAGGG - Intronic
1158080310 18:53582311-53582333 GAACTAGAACATCTGGGGCTGGG - Intergenic
1158545093 18:58389309-58389331 GAGCTTGGACTGCTGGGGGAGGG + Intronic
1159033805 18:63258154-63258176 GAGCTGGAAGAGGTGGGGGGTGG + Intronic
1160994995 19:1878394-1878416 GTGCTGGATCAGCTGGGTCAGGG - Intronic
1161103263 19:2431824-2431846 GGGCCAGAGCAGCTGGGGCACGG - Exonic
1161591041 19:5129182-5129204 GAGCTGGAGCAGGGAGGGCAGGG + Intronic
1161970783 19:7578778-7578800 TAGCTGAAACAGCCTGGGCACGG - Intergenic
1162110973 19:8399593-8399615 GGGCTGTCCCAGCTGGGGCAAGG - Intronic
1162372425 19:10287448-10287470 GGGCTGGAAGAGGTGGGGGAAGG + Intronic
1162904941 19:13817808-13817830 GAGGTGGCACTGCTGGGGCTGGG + Exonic
1163241067 19:16064285-16064307 CAGCCTGAACAGCTGGGGCAGGG + Intergenic
1164474217 19:28562750-28562772 GAGCTGGAACAGAAGTGGAAGGG + Intergenic
1164618668 19:29681181-29681203 GAGGTGGGAGAGCTGGAGCAGGG - Intergenic
1164833190 19:31338957-31338979 GAGTCGGACAAGCTGGGGCAGGG - Intronic
1164895712 19:31875763-31875785 GAGCTGGCACAGCTCGCGCCCGG - Intergenic
1166293725 19:41878909-41878931 GTGCTGGAACTGCAGGGGCCAGG + Intronic
1166388544 19:42396022-42396044 GAGCTGGGACTCCTGGGGCTGGG - Intergenic
1166569607 19:43785184-43785206 GAGGTGGTGCAGCTGGGACAAGG - Intergenic
1166944889 19:46390558-46390580 GAGGTGGAGCAGCTGGGGCTGGG + Exonic
1167116300 19:47491120-47491142 CACCTGGCTCAGCTGGGGCAGGG + Intronic
1167534557 19:50041484-50041506 AAGCTGTGACAGCTGGGGCTGGG - Intronic
1168419612 19:56192747-56192769 GACCTGGAGCTCCTGGGGCATGG + Exonic
1168421354 19:56206197-56206219 GACCTGGAGCTCCTGGGGCATGG - Exonic
1168424105 19:56224741-56224763 GACCTGGAGCTCCTGGGGCATGG + Exonic
1168426609 19:56244326-56244348 GACCTGGAGCTCCTGGGGCATGG - Exonic
925379367 2:3414543-3414565 CAGCGGGGACAGCTGGGGGATGG - Intronic
925638473 2:5965155-5965177 TGGCTGGAGCAGCTGGGACACGG + Intergenic
926926463 2:17993170-17993192 GAGCTAGAGCAGCTAGGACACGG - Intronic
927785792 2:25973818-25973840 GGGGTAGAACAGCTGGTGCAGGG + Intronic
928233884 2:29523248-29523270 GAGCTGGCTCTGCAGGGGCAAGG - Intronic
928964289 2:36961903-36961925 CAGAAGGAACAGCTGGGGGAAGG - Intronic
930024461 2:47021702-47021724 GAGCTGGGATCTCTGGGGCAAGG + Intronic
930026234 2:47030700-47030722 GAGGGGGAACAGGCGGGGCAGGG - Intronic
931012238 2:57930009-57930031 GAGCTGCACCACCTGGGGCTGGG + Intronic
931218828 2:60270814-60270836 GGTTTGGAACACCTGGGGCATGG - Intergenic
931684920 2:64784748-64784770 CAGCTGGAGCAGCAGGGTCAAGG + Intergenic
931892012 2:66683626-66683648 GAGCTCTAACTGCTGGGGGAGGG + Intergenic
932059710 2:68483383-68483405 GAGATGGGACAGCAGAGGCAGGG + Intronic
934062567 2:88308954-88308976 GATCTGGAACTCCTGGGCCATGG - Intergenic
934118228 2:88815664-88815686 GAGCTGGAGCAGCTGGGATAAGG - Intergenic
934675946 2:96249839-96249861 GAGGTGGTGCATCTGGGGCAGGG - Exonic
935137645 2:100321792-100321814 GAGCTGGAAGAGCTGGCGGGCGG - Exonic
935222174 2:101024774-101024796 GAGGTGGAACTGTTGGGTCATGG - Intronic
935377670 2:102416692-102416714 GGGTTAGAACAGCTGGGGCCTGG + Intergenic
935442870 2:103122699-103122721 GAGCTGGAGCAGCCTGGGTATGG - Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
936250533 2:110864968-110864990 GACCCGGGACAGTTGGGGCATGG + Intronic
936558210 2:113514267-113514289 GAGCTGAAGCAGCTGCAGCAGGG + Intergenic
937078708 2:119125412-119125434 GGGCTGGCAGAGCTGGGGCCTGG - Intergenic
937413503 2:121696653-121696675 GAAGAGGAACAGCTGGGGCTGGG + Intergenic
938778755 2:134565269-134565291 GGGATGGAATAGCTGGGTCATGG - Intronic
940430449 2:153584036-153584058 GGGCTGTGACAGCTGGGGTAGGG + Intergenic
940518509 2:154712948-154712970 GCTGTGGAACAGCTGGTGCAAGG + Intronic
942904765 2:181167061-181167083 CAGCTGGAATGGCTGGGACAAGG + Intergenic
944417897 2:199497122-199497144 GAACTGGAACATCTGGGGGCTGG - Intergenic
945046711 2:205788381-205788403 GATCTGCAACAGCTGGGGAAGGG + Intronic
945097020 2:206229902-206229924 GAGCAAGAAGAGCTGGGGCTGGG + Intergenic
946934862 2:224709384-224709406 GAGCTGGAACAGCCTGAGAATGG - Intergenic
947605675 2:231483783-231483805 TTGCTGGAGGAGCTGGGGCAGGG + Intergenic
947646868 2:231748754-231748776 CGGCTGGAGCAGCTGGGACATGG - Intronic
948160824 2:235822668-235822690 GAGCTGGAGAAGCTTGGGAATGG + Intronic
948469366 2:238167402-238167424 GAGGTGGAAAAGGTGGGGCTGGG - Intronic
948623161 2:239249351-239249373 GAGCTGGGAGAGATGGGGAAAGG + Intronic
948639279 2:239364178-239364200 GGGCTGGCATTGCTGGGGCATGG - Intronic
948944569 2:241213003-241213025 GGGCTGGGACAGCTGGGGTGGGG - Intronic
949071276 2:242026117-242026139 GAGCAGGACCAGCTGGGACAGGG - Intergenic
1168759761 20:342021-342043 GAGCTGGAGCAGCTGGGAGCTGG - Intergenic
1168960277 20:1864311-1864333 CAGCTGGGACAGGTGGGTCATGG + Intergenic
1168981296 20:2006185-2006207 AAACTGATACAGCTGGGGCAAGG + Intergenic
1169130827 20:3165711-3165733 GAGCTGGCCGAGCTGCGGCAGGG - Intronic
1169170934 20:3464377-3464399 GAGCTGGAACAGGCAGGGAAGGG + Intergenic
1169849196 20:10031849-10031871 GAGCTGGCACTGCTGGGGGACGG - Intronic
1170003999 20:11646487-11646509 GAGGAGGCACAGCTGGGTCAAGG + Intergenic
1170719062 20:18859489-18859511 GAGCTGGAGCAGCAGGGATAAGG - Intergenic
1170794414 20:19533862-19533884 GATGTGGGACAGCTGGGGGAAGG - Intronic
1170900370 20:20456678-20456700 TAGCTGGAACAGCTTGGGGCTGG - Intronic
1171070414 20:22062766-22062788 CAGCTTGCCCAGCTGGGGCAAGG - Intergenic
1171245326 20:23606140-23606162 GTGCTGGGGCAGCTGGGGCTGGG - Intergenic
1171399653 20:24864688-24864710 GAGCTGGAGCAGCTGGGACTTGG - Intergenic
1171964304 20:31517634-31517656 GAGCAGGAGAAGGTGGGGCAGGG + Intronic
1172261331 20:33568495-33568517 CTGCTGGAAGAGCTGGGGGATGG + Intronic
1172416722 20:34775129-34775151 AAGCTGGAACACAGGGGGCAAGG + Intronic
1172654264 20:36527439-36527461 GAGCGGGGATAGCTGGGGAAAGG - Exonic
1172930009 20:38579805-38579827 GGGCTGGGAGAGCTGGGGCATGG - Intergenic
1173225982 20:41162754-41162776 GGGGTGGAAGAGCAGGGGCAGGG - Intronic
1173263862 20:41460509-41460531 TGGCTGGAACAGTTGGGACAGGG - Intronic
1173547772 20:43912481-43912503 GAGCTGGCAGAGCTGGGGACTGG + Intergenic
1174466030 20:50718137-50718159 GAGCTGGGAGAGCTTGGACAGGG - Intergenic
1174578683 20:51555652-51555674 GGGCTGGATCAGAAGGGGCAGGG - Intronic
1175419030 20:58819882-58819904 GAGGTAGAACAGCTGGGACCCGG + Intergenic
1175638886 20:60610194-60610216 GAAGTGGAATAGCTGGGTCAAGG + Intergenic
1175812156 20:61864199-61864221 GAGCTGGAAGGGCCAGGGCAGGG + Intronic
1176039289 20:63055957-63055979 GAGCAGGAGCAGCTGGAGCTTGG + Intergenic
1176673002 21:9751762-9751784 GGTCTGGAAGAGCTGTGGCAGGG - Intergenic
1177479639 21:21669728-21669750 TGGCTGGAGCAGCTGGGGCACGG + Intergenic
1178896845 21:36565812-36565834 GATCTTGAGCAGCTGTGGCAAGG - Intronic
1179169572 21:38962483-38962505 GAGCTGGAACTGATGGGACTGGG - Intergenic
1179810270 21:43865441-43865463 GAGGTCGGACGGCTGGGGCAGGG - Intronic
1179818816 21:43924687-43924709 CAGATGAAACAGCCGGGGCAAGG - Intronic
1179819012 21:43925628-43925650 GAGCTGGAGGCGCTGGGGCTGGG - Intronic
1179877231 21:44275244-44275266 GAGGTGGGGCAGATGGGGCAGGG - Intergenic
1180017408 21:45096393-45096415 GGGCCGGCACAGCTGGTGCAGGG - Intronic
1180061014 21:45385113-45385135 GAGCTGGAGCTGCTGGAGCTGGG - Intergenic
1180198320 21:46210359-46210381 GAACTGGAACTGCTTGGGCCAGG - Intronic
1180712123 22:17846513-17846535 GAGCGGTAACAGCAGGGGCCTGG + Intronic
1180814739 22:18782268-18782290 GAGCTGGCACACCAGCGGCATGG - Intergenic
1181121053 22:20668928-20668950 TTGCTGGATCAGCTGGGTCAGGG - Intergenic
1181200926 22:21216604-21216626 GAGCTGGCACACCAGCGGCATGG - Exonic
1181334017 22:22115954-22115976 GTGCTGGATCAGCTGGGTCAAGG - Intergenic
1181646213 22:24232924-24232946 GGGCTGGAACAGCTGCGCCCAGG + Exonic
1181700817 22:24620369-24620391 GAGCTGGCACACCAGCGGCATGG + Exonic
1181911067 22:26238731-26238753 CAGATGGAAAAGCTGAGGCATGG + Intronic
1182357936 22:29730629-29730651 GGGATGGCACAGCTGGGGCATGG - Exonic
1182419235 22:30240850-30240872 GAGCTGGACTGGCTGGGTCAGGG + Exonic
1182420419 22:30246037-30246059 ATGCTGGAACAGCGGGGACAGGG + Intronic
1182481670 22:30613211-30613233 GCGCGGGAAAAGCTGGGTCAAGG - Intronic
1183454012 22:37911741-37911763 GAGCTGGAGCTGCCAGGGCAGGG - Intronic
1183950033 22:41347663-41347685 GACCTGGAAGAGCTAGGGGAAGG - Intronic
1203225991 22_KI270731v1_random:78831-78853 GAGCTGGCACACCAGCGGCATGG + Intergenic
1203264836 22_KI270734v1_random:7955-7977 GAGCTGGCACACCAGCGGCATGG - Intergenic
949158833 3:857149-857171 GAACAGGACCAGCTGGGACAGGG + Intergenic
950097164 3:10337088-10337110 GAGCTGGCACAGCTGGGGTGGGG - Intronic
950101437 3:10359279-10359301 GAACTGGAACCTCTGGGGCAAGG - Intronic
951557888 3:23938968-23938990 GAGCTGAAACAGCAGGGGGTTGG - Intronic
953359169 3:42280053-42280075 GAGCTGGAACAGCAGCAGCTGGG - Intergenic
953882045 3:46695620-46695642 GAACAGGGACAGGTGGGGCAAGG + Intergenic
953910365 3:46889723-46889745 GATATGGGACAGCTGGTGCAGGG + Intronic
954372402 3:50175693-50175715 GGGCTGGGAGAGCTGGGGCTGGG + Intronic
954448843 3:50560972-50560994 GAGCAGGAGCTGCTGGAGCATGG - Exonic
954751817 3:52818166-52818188 GGGCTGGGACAGCCGGGGCACGG + Exonic
958734491 3:97992975-97992997 GAGGTAGGACACCTGGGGCATGG + Exonic
961003590 3:123390174-123390196 GAGCTGCATCTGCTGGGGAAGGG - Intronic
961262468 3:125613428-125613450 GAGCAGGAACAGCTCGTGAAGGG - Intergenic
961578786 3:127860623-127860645 GAGCTCAAACTGTTGGGGCAGGG - Intergenic
961633497 3:128318444-128318466 GAGCAGGAACGGGTGGGACAGGG - Intronic
961662595 3:128477560-128477582 GGGCTGGGGCAGCTGGGACAAGG + Intergenic
962066979 3:131991832-131991854 GAGCTGAAGCAGCTTGGACATGG - Intronic
962660283 3:137595437-137595459 GAGATGTAATTGCTGGGGCAGGG + Intergenic
962989338 3:140564251-140564273 GAGCTGGACTAGATGGGGCAGGG - Intronic
963038333 3:141051244-141051266 GAGCTGGGACGGCCGGGGCGCGG + Intergenic
963254467 3:143130924-143130946 GAGTTGGATCAGCTGAGGCTGGG + Intergenic
963521148 3:146361227-146361249 GAGCAGGAACAGTTGGGACTTGG - Intergenic
963572496 3:147015626-147015648 GAGCTAGAGCATCTGGGACATGG - Intergenic
963683295 3:148408478-148408500 GAGCTGGAATAGCTGTGACTTGG - Intergenic
964454237 3:156843567-156843589 GAGCTGTTACTGCTGGGGAAAGG - Intronic
964970437 3:162553406-162553428 GAGCTGAACCAACTGGGGGAAGG + Intergenic
965112310 3:164443404-164443426 CAACTGGAGCAACTGGGGCAGGG + Intergenic
965310124 3:167116554-167116576 GAGGAGGCACAGCTGGGCCAGGG - Intergenic
966226683 3:177605417-177605439 GAGATGGAACATCTGGGAAATGG + Intergenic
966727543 3:183120812-183120834 GAGGTGCTACACCTGGGGCAGGG + Intergenic
967814935 3:193790554-193790576 GAGGTGGAAGAAGTGGGGCAAGG + Intergenic
967882829 3:194313975-194313997 AGGCTGTCACAGCTGGGGCAGGG - Intergenic
967971876 3:195005279-195005301 GAGAGGGAAGAGCTGGGGAAAGG + Intergenic
968050569 3:195652062-195652084 GAGCAGGACCAGCTGGGACAGGG - Intergenic
968096753 3:195936797-195936819 GAGCAGGACCAGCTGGGACAGGG + Intergenic
968105256 3:195996291-195996313 GAGCAGGACCAGCTGGGACAGGG + Intergenic
968173406 3:196528645-196528667 GAGCTAGCAAAGCTGGGGCGAGG - Intergenic
968303545 3:197633868-197633890 GAGCAGGACCAGCTGGGACAGGG + Intergenic
969580761 4:8063529-8063551 GAGGTGGAAGAGCTTGAGCAAGG + Intronic
971470864 4:27025003-27025025 GAGCAGGACCAGCTGGGGGCCGG + Intronic
972366117 4:38376598-38376620 GTGCTGCAGTAGCTGGGGCATGG + Intergenic
973271536 4:48267852-48267874 GAGCTGGAACAGCTGGGGCAGGG + Intronic
977069987 4:92373413-92373435 GGGCTGACACAGCTGGGCCATGG - Intronic
980092963 4:128461420-128461442 GAGATGGAACAGCAAGGGCAAGG - Intergenic
980153734 4:129080010-129080032 GAGCTGAAGCAGCTGGGACCAGG + Intronic
980599811 4:135007630-135007652 GGGCAGGAAGGGCTGGGGCAGGG - Intergenic
981075378 4:140586193-140586215 GAGCTAGAGCATCTGGGCCATGG + Intergenic
981552637 4:145957466-145957488 TGGCTGGAACAGCTGGGGGCTGG - Intergenic
981840314 4:149103962-149103984 GAGCCAGAACAGCAGAGGCAGGG - Intergenic
981874870 4:149529968-149529990 TAGCTGGAACAGATGGATCAAGG - Intergenic
982121277 4:152145747-152145769 CAGCTGGAGCAGCTGGGACATGG + Intergenic
983889460 4:173015962-173015984 GAGCTGAAGCAGCTGGGACACGG - Intronic
984110841 4:175611894-175611916 GATCTGGAATACTTGGGGCAAGG + Intergenic
984918963 4:184747491-184747513 GAGCTGGAATAACTGAGGCATGG + Intergenic
985401690 4:189599866-189599888 GGTCTGGAAGAGCTGTGGCAGGG + Intergenic
985507309 5:290745-290767 GAGCAGGACCAGCTGGGACAGGG - Intronic
985713545 5:1443387-1443409 GAGATGGTACAGCTGGGGCACGG + Intronic
985740664 5:1614390-1614412 GAGCAGGACCAGCTGGGACAGGG + Intergenic
985838797 5:2290367-2290389 GACCTAGAACTGCAGGGGCAGGG - Intergenic
985983056 5:3488337-3488359 GAGCTGGAAACGCTTGGGCCTGG + Intergenic
986707552 5:10464072-10464094 CGGCTGGGACAGGTGGGGCAGGG - Intronic
987034226 5:14004209-14004231 GATAAGGAACAGCTGGGCCAGGG - Intergenic
988147637 5:27330924-27330946 GAGCTGGAGTGGCTGGGACAAGG - Intergenic
988997632 5:36729652-36729674 GAGCTGGCAGAGCTGTGGTAAGG + Intergenic
989161823 5:38398648-38398670 GAGCCAGCACAGCTGGAGCACGG + Intronic
990237240 5:53781392-53781414 GAACAGAAACAGGTGGGGCAAGG - Intergenic
991495236 5:67219803-67219825 GAGCCAGACCAGCTGGGGCTGGG - Intergenic
991986187 5:72289099-72289121 GGTCAGGAACAGCTGGGCCAAGG - Intronic
992995458 5:82328396-82328418 GAGCTGGAAGAGGTGGGGGAGGG - Intronic
994787241 5:104180478-104180500 GAGGTGGAAGATCTGTGGCATGG - Intergenic
995991678 5:118247414-118247436 GCCCTTGAACAGCTGGAGCACGG + Intergenic
996249995 5:121317602-121317624 GTGGTGGCACAGGTGGGGCAGGG + Intergenic
996453730 5:123656404-123656426 GAGCTGGAACAGCTGGGACACGG + Intergenic
996518410 5:124399293-124399315 GATTTGGAACAGCTGGGGGCTGG + Intergenic
997473535 5:134129941-134129963 GAGCTGGAAGGGGTGGGGGATGG - Intronic
998193076 5:140043196-140043218 GAGGTGGCCCAGCTAGGGCAGGG + Exonic
998413735 5:141930224-141930246 GAGCTGGAAGAGCTGCTGAATGG - Exonic
999109517 5:149106316-149106338 CAGCTGGAACATCAGGGCCAGGG - Intergenic
1000646899 5:163770100-163770122 GAGCTGGAACAGTGGAGGAAAGG - Intergenic
1002079551 5:176729152-176729174 GAGCAGGCAAAGCTGGGCCAAGG - Intergenic
1002297725 5:178240616-178240638 GGGCGGGGACAGCAGGGGCAGGG - Intronic
1003509200 6:6765295-6765317 GAGCTGTGCCAGCTGGGTCAAGG + Intergenic
1004755781 6:18608733-18608755 GAGCTGGAGCAGCTGGGATATGG + Intergenic
1004757633 6:18630168-18630190 GAGATGGGAAAGCTGAGGCATGG - Intergenic
1005463130 6:26087726-26087748 GAGCCGGGACAGCCGGGGGAGGG - Intronic
1005543255 6:26835866-26835888 GAGCTGGAGCTGCTGGGACACGG - Intergenic
1005908209 6:30284134-30284156 GAGCTGGAGCAGCTGGGATTTGG + Intergenic
1006804556 6:36779695-36779717 GTGTTGGGTCAGCTGGGGCAGGG - Intronic
1008417196 6:51255626-51255648 GAGGTGGCACAGCAGAGGCATGG - Intergenic
1008813516 6:55534633-55534655 GAGCTGCAACAGCAGGGGCAGGG - Intronic
1010943035 6:81941682-81941704 GAGCTTGAATAGGTTGGGCAAGG + Intergenic
1011073358 6:83410004-83410026 CAGCTGGAACTGCTGGGTAAAGG - Intronic
1011535374 6:88370693-88370715 GAGCTGGGACAGCTCAGGAATGG - Intergenic
1013073445 6:106750101-106750123 AACCTGGAACAGCTGGGCAAGGG - Intergenic
1014116029 6:117669863-117669885 GGGCTGGAATGGCTGGGACATGG - Intergenic
1014843880 6:126252211-126252233 GAGCTGGGACAGCTGGGACTTGG + Intergenic
1015291861 6:131546496-131546518 GAGCTGGAACAACAGGCTCAAGG - Intergenic
1015317483 6:131832697-131832719 GAGTTGGAACAGCAAGGGCTGGG + Intronic
1015757068 6:136618356-136618378 TAGCTTGAACAGCTGGTGCAGGG - Intronic
1019224720 6:170500426-170500448 GAACTAGAACCACTGGGGCAGGG - Intergenic
1019274024 7:166531-166553 GAACAGGAACAGCTGGGGAAAGG + Intergenic
1019393777 7:805465-805487 GAAGTGGAACTGCTGGGTCAAGG - Intergenic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1019824114 7:3269273-3269295 GAGCTGGAAGAGGTGGGACTGGG - Intergenic
1019895939 7:3983189-3983211 TAGCTGGTAAAGCTGTGGCAGGG + Intronic
1023351921 7:39328825-39328847 CAGCTGGACCAGATAGGGCATGG + Intronic
1023353062 7:39339660-39339682 GAGCTGGAGCTGCTGGAGCTGGG - Exonic
1023616620 7:42026273-42026295 GTGTTGGAAAAGTTGGGGCAGGG + Exonic
1024002889 7:45202641-45202663 GAGCTGGTGCTGCTGGGGCTGGG - Intergenic
1025188108 7:56876588-56876610 GGGCAGGGGCAGCTGGGGCACGG + Intergenic
1025683815 7:63700334-63700356 GGGCAGGGGCAGCTGGGGCACGG - Intergenic
1025943541 7:66089786-66089808 GGGCTGGAGGACCTGGGGCAGGG + Intronic
1026111926 7:67465314-67465336 CAGCAGCAACAGCTGGAGCATGG + Intergenic
1027143639 7:75678745-75678767 GAGCTGGAAAAGCACGGGCCTGG - Intronic
1029163704 7:98571185-98571207 GAGCTGGGAGAGGTGGGGGAGGG - Intergenic
1029243548 7:99181982-99182004 GAGCTGGATCAGCTGATCCATGG + Exonic
1029438913 7:100576891-100576913 TAGCTGGACCAGGTGGGACAGGG - Exonic
1029609894 7:101621277-101621299 TTGCTGGAGCATCTGGGGCAGGG + Intronic
1029737686 7:102473712-102473734 GAGCTGGAACAGCTGGGGCAAGG + Intronic
1031094872 7:117405492-117405514 GGTCTGGAAGAGCTGGTGCAGGG - Intronic
1031612002 7:123839127-123839149 GAGGTGGGAGAGCTGGGGGAGGG - Intronic
1032536540 7:132669251-132669273 GAGCTGGAGAAGCTTGGTCAGGG - Intronic
1032804041 7:135338618-135338640 GAGGAGGAGGAGCTGGGGCAGGG - Intergenic
1034552509 7:151830507-151830529 GAGCTGGAAGGACTGGGGGACGG + Intronic
1034566543 7:151920099-151920121 TAGCTGGAACTGCAGGTGCACGG - Intergenic
1035936585 8:3847732-3847754 GAGCTGGAACTGCAGTGTCAGGG - Intronic
1036694069 8:10963340-10963362 GAGGTGGAACATTTGGAGCAGGG - Intronic
1036703553 8:11030099-11030121 GAGCTGGGACAGCTGCAGCTAGG - Intronic
1037205987 8:16320727-16320749 GAGCAGAAGCAGCTGGGACATGG - Intronic
1037973465 8:23191886-23191908 GAGCTGGTACAGCAGGCCCAGGG - Exonic
1038052154 8:23824250-23824272 GAACTGGAAGAGCTGGAGGAGGG - Intergenic
1039818250 8:41113755-41113777 GTGCCTGAACTGCTGGGGCAGGG - Intergenic
1039821154 8:41136803-41136825 GAGCTGGAGAAGCAGAGGCAGGG - Intergenic
1041219422 8:55633932-55633954 GAGCCAGAACAGGTGAGGCAGGG - Intergenic
1042483301 8:69326765-69326787 GAGCAGGACCAGCTGGGACAGGG - Intergenic
1042505783 8:69558344-69558366 CAGTTGAAACAGCAGGGGCAGGG - Intronic
1043919227 8:85962057-85962079 GACCTGGAAAAGCAGGGGCTGGG - Intergenic
1046455340 8:114452580-114452602 GATCTGGAGCAGCATGGGCAAGG - Intergenic
1046909713 8:119612113-119612135 GAGCTGGAAATGCTGGGGGAAGG + Intronic
1047497601 8:125419590-125419612 GGGCTGGGACAGCTGTGGGACGG + Intergenic
1047643637 8:126846949-126846971 GGCCTAGAACAGCTGGGCCAAGG + Intergenic
1048730438 8:137434360-137434382 GAGCTGGAGCAGCATGGGCCTGG - Intergenic
1049069531 8:140345868-140345890 GAGATGGACCACCTGGGGCCTGG + Intronic
1049205621 8:141362170-141362192 GAGCAGGAACAGCTTGGGGTTGG - Intronic
1049391155 8:142372386-142372408 GAGCTGGAGAGGCTGGGACACGG + Intronic
1049630411 8:143651704-143651726 GAGCTGGAACAGTAGGGGCAGGG + Exonic
1049659474 8:143813333-143813355 AAGCTGGAACAGCTGGATCTGGG - Exonic
1049687912 8:143946349-143946371 GAGCTGATTCAGCTGGGCCAAGG - Intronic
1049894652 9:101999-102021 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1049932620 9:471211-471233 GAGCTGGCGAAGCTGGGCCAAGG + Intronic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1050394263 9:5178333-5178355 AAGCTGGAACAGCTGAGTAAAGG - Intronic
1052345682 9:27407502-27407524 GAGCATGAACCCCTGGGGCATGG + Intronic
1052791312 9:32877784-32877806 GTCCTCTAACAGCTGGGGCATGG - Intergenic
1052989156 9:34508577-34508599 GAGCTGGGAAAGCAGGGGCAGGG - Intronic
1053263686 9:36694660-36694682 GACCTGGAACACCTTGGGTAAGG + Intergenic
1053468755 9:38330233-38330255 AAGCTGCAATAGCTGGGGCCGGG + Intergenic
1053735859 9:41101989-41102011 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1054692515 9:68329409-68329431 GAGCTGAAGCAGCTGCAGCAGGG + Intronic
1054796911 9:69310925-69310947 CAGCTGGAACAGCTGGAACCAGG + Intergenic
1056021255 9:82440674-82440696 GAGCTGGAGCAGCAGGGATATGG - Intergenic
1056084890 9:83137624-83137646 AAGCTAGGTCAGCTGGGGCAGGG + Intergenic
1056394596 9:86170001-86170023 GAGCTGGAGAACCTGCGGCATGG + Intergenic
1057575259 9:96237379-96237401 GAGCTGCAACAGCTGGCCCATGG - Intronic
1057955091 9:99401051-99401073 AAGTTGAAACAGCTGGGGGAGGG - Intergenic
1058174506 9:101722125-101722147 CAGCTGGAGCAGCTGGGACACGG - Intronic
1058283691 9:103150253-103150275 TGGCTGGAGCAGCTGGGACACGG - Intergenic
1058409060 9:104710415-104710437 GAGTTGGCACAGCAGGGTCAGGG + Intergenic
1060891987 9:127194954-127194976 CAGCTGTCACAGGTGGGGCAAGG - Intronic
1061043617 9:128152968-128152990 CAGCTGGGCCAGGTGGGGCAGGG + Intronic
1061208533 9:129177711-129177733 GAGCTGGTGCAGCTGGTGCCGGG + Exonic
1061411783 9:130425820-130425842 GTGCTGCACCAGCTGGGGCTGGG - Exonic
1061487450 9:130927507-130927529 CAGCTGGCACAGATGGGGCCTGG + Intronic
1062077043 9:134595144-134595166 GGGCCCCAACAGCTGGGGCAAGG - Intergenic
1203376811 Un_KI270442v1:383279-383301 GGGCCGGAACAGGGGGGGCAGGG - Intergenic
1185431135 X:12833-12855 GAGCTGGAACCACAGGGGCGGGG - Intergenic
1185440402 X:225230-225252 GAGCTGGAACCACAGGGGCGGGG - Intergenic
1186626033 X:11295036-11295058 GATTTGGTACAGCTGGGGCGGGG + Intronic
1186634448 X:11387279-11387301 GAGCTGGAATCTCTGGGGCTTGG + Intronic
1186959677 X:14722252-14722274 GGGCTGGAACAGCTGGGAGTTGG + Intronic
1187555166 X:20344509-20344531 TGGCTGGAACAGCTGGGACCAGG - Intergenic
1188329763 X:28854680-28854702 GAGCAGGAACAATTGGGGCAGGG + Intronic
1188781781 X:34294874-34294896 GAGCTGAAGCAGCTGATGCAGGG - Intergenic
1188888691 X:35582796-35582818 GAGCTGGAACAGCTAGGATGTGG - Intergenic
1189250105 X:39594194-39594216 GCCCAGGAACAGCTGGGACAAGG + Intergenic
1189886055 X:45545989-45546011 GAGCTGGAGCAGCTGGGATATGG - Intergenic
1190061462 X:47214505-47214527 GAGGGGGAACAGCAGGGTCATGG - Intronic
1190292044 X:48999675-48999697 GAGCTGGAAAAGGTGAGCCAGGG - Intronic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1190911311 X:54774834-54774856 GGGCTGGGACAGCTGAGGGAAGG + Intronic
1190919906 X:54841376-54841398 GGGCTGGGACAGCTGAGGGAAGG - Intergenic
1191010700 X:55754783-55754805 TAGCTGGTATAGATGGGGCAAGG + Intronic
1192056810 X:67781623-67781645 GAGCTGCAAAAGAAGGGGCATGG - Intergenic
1192155713 X:68745024-68745046 GAACTGGCAGAGCTGGGACATGG - Intergenic
1192229383 X:69254654-69254676 GGGAGGGAACAGCTTGGGCAGGG + Intergenic
1192259846 X:69498832-69498854 GAGCTGGGATAGATGGGGCTGGG - Intergenic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1192742406 X:73906007-73906029 TGGCTGGAGCAGCTGGGACATGG - Intergenic
1193692711 X:84667407-84667429 ATGCTGCAACTGCTGGGGCATGG - Intergenic
1194566396 X:95494282-95494304 TGGCTGAAGCAGCTGGGGCACGG - Intergenic
1196920043 X:120575932-120575954 GAGCGGGAAAAGGTGGGGGATGG + Intergenic
1197713430 X:129688485-129688507 GGGCTGGAGCAGCTGGGGACAGG + Intergenic
1197761834 X:130033490-130033512 TAGCTAGAAGACCTGGGGCAAGG - Intronic
1198954192 X:142109501-142109523 GAATTGGAACAGCTGGGAAATGG + Intergenic
1200249615 X:154545966-154545988 TAGTTGGAAAAGCTGAGGCATGG + Intronic
1201291570 Y:12425343-12425365 GGGCTGGAGAAGGTGGGGCATGG + Intergenic
1201569527 Y:15399325-15399347 AAGCTGGAACAGCTGGGATGTGG - Intergenic