ID: 973271899

View in Genome Browser
Species Human (GRCh38)
Location 4:48270063-48270085
Sequence GACGCTCCCTGAAACTCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973271899_973271903 -8 Left 973271899 4:48270063-48270085 CCCGGTGAGTTTCAGGGAGCGTC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 973271903 4:48270078-48270100 GGAGCGTCCCTTAGGTTTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 62
973271899_973271902 -9 Left 973271899 4:48270063-48270085 CCCGGTGAGTTTCAGGGAGCGTC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 973271902 4:48270077-48270099 GGGAGCGTCCCTTAGGTTTCCGG No data
973271899_973271906 -3 Left 973271899 4:48270063-48270085 CCCGGTGAGTTTCAGGGAGCGTC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 973271906 4:48270083-48270105 GTCCCTTAGGTTTCCGGGGGCGG No data
973271899_973271905 -6 Left 973271899 4:48270063-48270085 CCCGGTGAGTTTCAGGGAGCGTC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 973271905 4:48270080-48270102 AGCGTCCCTTAGGTTTCCGGGGG No data
973271899_973271904 -7 Left 973271899 4:48270063-48270085 CCCGGTGAGTTTCAGGGAGCGTC 0: 1
1: 0
2: 0
3: 10
4: 78
Right 973271904 4:48270079-48270101 GAGCGTCCCTTAGGTTTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973271899 Original CRISPR GACGCTCCCTGAAACTCACC GGG (reversed) Intergenic
900184545 1:1326949-1326971 GACACTGCTTGAAACTGACCAGG - Exonic
900430393 1:2598635-2598657 GACCCTCCCTGGGCCTCACCTGG + Exonic
906611693 1:47208428-47208450 GACGCTCCCTGGAAAGCACAGGG + Intergenic
906657337 1:47558174-47558196 GAGCCTCCATGAATCTCACCTGG - Intergenic
915561449 1:156690485-156690507 GACTCTCTCTGAGACTCAGCTGG + Intergenic
917616103 1:176746048-176746070 GAGTGTCCCTGAAACTCACTAGG + Intronic
919927098 1:202197456-202197478 GAGGCTCATTGACACTCACCGGG + Intronic
920301791 1:204993496-204993518 GGTGCTCCCTGAAACCCACCTGG + Intronic
923267391 1:232327861-232327883 GAGGTTCCCGGAAACTCACCAGG - Intergenic
1063868882 10:10397069-10397091 GATGCTCCCTCAAACTCAACTGG + Intergenic
1067158706 10:43804134-43804156 CACACTCCTGGAAACTCACCTGG + Intergenic
1067776304 10:49167225-49167247 AAGGCTCCCTGAAGCTCACCTGG + Intronic
1073572066 10:104589130-104589152 GACATTCTCTGAAACACACCAGG - Intergenic
1074662671 10:115679361-115679383 AACCCTCTCTGAAACTCACTGGG + Intronic
1075381442 10:122022011-122022033 GAAGCTTCCTGACACCCACCTGG - Exonic
1076114320 10:127884894-127884916 GATGTTCCATGAAAGTCACCAGG + Intronic
1076867330 10:133174468-133174490 GACACTGCCTGATACACACCCGG - Intronic
1076903347 10:133350568-133350590 GACACCCCTTGATACTCACCTGG + Intronic
1103535353 12:121630034-121630056 GACCCTCCCTCAATCTCACCTGG - Intronic
1105541292 13:21319575-21319597 AACTCTCCCAGGAACTCACCCGG + Intergenic
1110590061 13:77246029-77246051 GACACTCCCAGAAACTGACTTGG + Intronic
1117472880 14:56064185-56064207 GATTCTCCCTTAAAATCACCTGG + Intergenic
1120887836 14:89465628-89465650 GAGACTCCCTGAAACTCACAGGG + Intronic
1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG + Intronic
1122714079 14:103683209-103683231 GACGCTCCCTGCACATTACCAGG - Intronic
1122812064 14:104293949-104293971 GCCCCTCCCAGACACTCACCCGG - Intergenic
1202921232 14_KI270723v1_random:31885-31907 GAGGCTCCCAGTCACTCACCAGG + Intergenic
1202923676 14_KI270724v1_random:5695-5717 GAGGCTCCCAGTCACTCACCGGG - Intergenic
1125505653 15:40266181-40266203 GAGGCACCCTGAAACTCGGCGGG - Exonic
1131165049 15:90136147-90136169 GACTGTCCCTGACACTCATCAGG + Intergenic
1135424205 16:22324280-22324302 GACTGTCCCGGGAACTCACCTGG - Intronic
1136913495 16:34162138-34162160 GGCGCTCCCCGATACTCACCAGG - Intergenic
1137449677 16:48559777-48559799 GAAGCTCTCTGAACCTCTCCTGG + Intronic
1138011866 16:53388814-53388836 GATGTTCCCTGATACTCTCCAGG - Intergenic
1140254608 16:73324190-73324212 GAGGCTTGCTGAAATTCACCTGG + Intergenic
1140574536 16:76150452-76150474 GGCGCTTCCTGCAACTTACCAGG - Intergenic
1141621860 16:85240551-85240573 GAGGCTCTCTGAGCCTCACCTGG + Intergenic
1142509646 17:385796-385818 CTCGCTCCCCGGAACTCACCCGG + Intronic
1144340988 17:14310199-14310221 TCCGATCCCTGAATCTCACCTGG + Intronic
1153724165 18:7937923-7937945 GAAGCTCCCTGAAATGGACCAGG - Intronic
1162740784 19:12772491-12772513 GACTCTGCCTGGAACTCAGCTGG - Intronic
1163398120 19:17075871-17075893 GAGGCTGCCTGGTACTCACCTGG - Exonic
1163834245 19:19563490-19563512 GACAGTGCCTGAGACTCACCTGG + Exonic
1164667335 19:30050282-30050304 CACGCTCCCTGAGACTCTCTGGG - Intergenic
925336361 2:3101917-3101939 CATGTTCCCTGAAACTCATCTGG + Intergenic
928296891 2:30091434-30091456 GACGCACCCTGAAATACACTGGG + Intergenic
933176905 2:79184675-79184697 GACTCTCCTTGAATCTCAGCAGG - Intergenic
933213261 2:79596207-79596229 GACGCTGCCTGGAACTTAGCAGG + Intronic
934950608 2:98572760-98572782 GACGCACCCAGGAACTCCCCCGG - Intronic
937138076 2:119572679-119572701 AAACCTGCCTGAAACTCACCTGG + Intronic
944799362 2:203222659-203222681 AACGTTCACTGAAAGTCACCAGG - Intronic
947153221 2:227135421-227135443 GACCCTACCTGAAATTCACAAGG + Intronic
1168787273 20:550812-550834 GACCATTCCTGAAATTCACCAGG - Intergenic
1169261047 20:4138250-4138272 GAGGTTACCTGAAACTCTCCAGG + Intronic
1172965809 20:38833947-38833969 AACGCTTCCTGAAACCAACCAGG + Intronic
1177688173 21:24467267-24467289 GACATTCCCTGAAATACACCAGG - Intergenic
1181856311 22:25783798-25783820 TAGGGTCCCTGAAACTCATCTGG - Intronic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
950024510 3:9810938-9810960 TTGGCTCCCTGGAACTCACCAGG - Intronic
952386202 3:32843313-32843335 GACACTCCCCCCAACTCACCAGG + Intronic
954622606 3:52004611-52004633 GCCGCTCCTTGAAACTCTCCTGG + Intergenic
971232132 4:24808490-24808512 GGAGCTCCCTAAATCTCACCTGG - Exonic
973271899 4:48270063-48270085 GACGCTCCCTGAAACTCACCGGG - Intergenic
978700379 4:111636850-111636872 GACGCTCTCTAAAATTCAGCAGG - Intergenic
985329998 4:188821562-188821584 TCCTCTCCCTGAAACACACCTGG - Intergenic
986912089 5:12570475-12570497 GACTCTCCCTCAAAGCCACCAGG + Intergenic
987970599 5:24939075-24939097 GACACTCCATGACACTGACCTGG + Intergenic
990206045 5:53430689-53430711 GAGGCTCACTGAAAATCACCGGG - Intergenic
993507721 5:88731868-88731890 GGCAATCCCCGAAACTCACCAGG - Exonic
995540816 5:113184300-113184322 TACCCTCCCTGAAACTCAACTGG + Intronic
997867925 5:137481229-137481251 GACCCTCCCTGAGGCTCCCCTGG + Intronic
999673839 5:153979636-153979658 GAAGCTCCCTGAAGCTGACAGGG - Intergenic
1003466365 6:6383647-6383669 GACACTGCCTGAAAAGCACCAGG - Intergenic
1008994058 6:57637777-57637799 GATTCTCCCTGAAAGTGACCGGG + Intronic
1014952044 6:127567770-127567792 GAAGCTCTCTGAACCTCTCCTGG + Intronic
1027413488 7:77947720-77947742 CAAGCTCCCTAAAACTCATCTGG + Intronic
1030664139 7:112255713-112255735 GACCCTCACTGTATCTCACCTGG + Intronic
1037228262 8:16622047-16622069 GAAGTTCCCTGAACCTCCCCTGG + Intergenic
1041858762 8:62486976-62486998 GACCCTCCCTGAATCTCATAAGG + Intronic
1045554795 8:103205726-103205748 GAAACTACATGAAACTCACCTGG - Intronic
1047529357 8:125661060-125661082 GTCACTGCCTAAAACTCACCAGG - Intergenic
1048117824 8:131545122-131545144 GACTCTCCCAGAATCTGACCAGG - Intergenic
1049577522 8:143396650-143396672 GACGCCCTCTGAATCTCTCCTGG + Intergenic
1057077304 9:92144910-92144932 GAGGCTCATTGACACTCACCGGG + Intergenic
1185892736 X:3835387-3835409 GTCGCTCCCGGAGCCTCACCTGG + Intronic
1185897844 X:3873807-3873829 GTCGCTCCCGGAGCCTCACCTGG + Intergenic
1185902963 X:3912238-3912260 GTCGCTCCCGGAGCCTCACCTGG + Intergenic
1198061724 X:133052671-133052693 GACTCTCCCTGAAATGCACATGG - Intronic
1200889092 Y:8303717-8303739 GACCCTCCCTTAACCTCACTGGG - Intergenic