ID: 973272125

View in Genome Browser
Species Human (GRCh38)
Location 4:48271897-48271919
Sequence TCTGAGGTCTGTTAGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973272125_973272138 25 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272138 4:48271945-48271967 TTGGGGAACCCTGATTTAACAGG No data
973272125_973272131 1 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272131 4:48271921-48271943 CGGTACTGGTCCACAGCCTGCGG No data
973272125_973272135 8 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272135 4:48271928-48271950 GGTCCACAGCCTGCGGGTTGGGG 0: 1
1: 7
2: 46
3: 161
4: 490
973272125_973272132 2 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272132 4:48271922-48271944 GGTACTGGTCCACAGCCTGCGGG No data
973272125_973272139 26 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data
973272125_973272133 6 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272133 4:48271926-48271948 CTGGTCCACAGCCTGCGGGTTGG No data
973272125_973272134 7 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272134 4:48271927-48271949 TGGTCCACAGCCTGCGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973272125 Original CRISPR TCTGAGGTCTGTTAGGAACC TGG (reversed) Intergenic
No off target data available for this crispr