ID: 973272127

View in Genome Browser
Species Human (GRCh38)
Location 4:48271904-48271926
Sequence GTACCGGTCTGAGGTCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1247
Summary {0: 1, 1: 3, 2: 48, 3: 388, 4: 807}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973272127_973272134 0 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272134 4:48271927-48271949 TGGTCCACAGCCTGCGGGTTGGG No data
973272127_973272133 -1 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272133 4:48271926-48271948 CTGGTCCACAGCCTGCGGGTTGG No data
973272127_973272138 18 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272138 4:48271945-48271967 TTGGGGAACCCTGATTTAACAGG No data
973272127_973272132 -5 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272132 4:48271922-48271944 GGTACTGGTCCACAGCCTGCGGG No data
973272127_973272135 1 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272135 4:48271928-48271950 GGTCCACAGCCTGCGGGTTGGGG 0: 1
1: 7
2: 46
3: 161
4: 490
973272127_973272131 -6 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272131 4:48271921-48271943 CGGTACTGGTCCACAGCCTGCGG No data
973272127_973272139 19 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973272127 Original CRISPR GTACCGGTCTGAGGTCTGTT AGG (reversed) Intergenic
901097950 1:6697638-6697660 GTACTGGTCTGTGGCTTGTTAGG - Intronic
901304480 1:8222853-8222875 GGACTGGTCTGTGGCCTGTTAGG + Intergenic
901516824 1:9753319-9753341 GTACTGGTCCGTGGCCTGTTAGG - Intronic
902536950 1:17124793-17124815 TTACCAGTCTGTGGTCTGTTGGG - Intergenic
902592709 1:17486404-17486426 TTACCTGTCTGTGGCCTGTTAGG + Intergenic
902803829 1:18848536-18848558 GTACCAGTCTGTGGCCTGTTAGG + Intronic
902938254 1:19780398-19780420 GTACTGGTCTGTAGCCTGTTAGG - Intronic
903088403 1:20885158-20885180 GTACCAGTCAGTGGCCTGTTGGG - Intronic
903442924 1:23401788-23401810 GTACCAGTCTGTGGCCTGTTAGG + Intronic
903450061 1:23447145-23447167 GTACAGGTCCAAGGCCTGTTAGG - Intronic
903525174 1:23987776-23987798 GTACCAGTCTGCGGCCTGTTAGG - Intergenic
905140753 1:35842182-35842204 GTAACAGTCTGTGGCCTGTTGGG + Intronic
905378107 1:37538800-37538822 GTACCAGTCCGTGGCCTGTTAGG + Intronic
905688916 1:39928408-39928430 GTACCGGTCTGTGGTCTGTTAGG + Intergenic
905763580 1:40581401-40581423 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
906118951 1:43374768-43374790 GTACTGGTCTGTGACCTGTTAGG - Intergenic
906435660 1:45794311-45794333 GTACCGGTCTGCAGCCCGTTAGG + Intronic
906864092 1:49397140-49397162 GTACTGGTTTGTGGCCTGTTAGG - Intronic
907057456 1:51383664-51383686 GTACCAGTCTGTGGCCTGTTAGG - Intronic
907127403 1:52063050-52063072 GTACCAGTCTGTGACCTGTTAGG - Intronic
907614183 1:55907093-55907115 GTACTGGTCTGTGGCCTGTTGGG + Intergenic
907892199 1:58647027-58647049 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
907911175 1:58828093-58828115 GTACCCATCTGTGGCCTGTTAGG + Intergenic
907977316 1:59444563-59444585 GTACTGGTCTGTAGCCTGTTAGG + Intronic
908102453 1:60805523-60805545 GTACCGGTCCATGGTCTGTTAGG - Intergenic
908155133 1:61345534-61345556 GTACCAGTCAGTGGCCTGTTAGG + Intronic
908172182 1:61516294-61516316 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
908309031 1:62857142-62857164 GTACCAGTCTGTGGCCTGTTAGG + Intronic
908588688 1:65604667-65604689 GTACCTGTCTGTGGCCTCTTAGG + Intronic
908611737 1:65868680-65868702 GTAGTGGTCTGTGGCCTGTTAGG + Intronic
908831703 1:68185432-68185454 GTACCAGTCAGTGGCCTGTTAGG + Intronic
909020062 1:70420588-70420610 GTACAGGTTTGTGGCCTGTTAGG - Intronic
909221602 1:72969313-72969335 GTACCTGTCTGTGGCCTGTTAGG - Intergenic
910315207 1:85874809-85874831 GTACCTGTCCAAGGCCTGTTAGG + Intronic
910415366 1:86991949-86991971 GTACTGGTTTGTGGTCTGTTAGG + Intronic
910953743 1:92679001-92679023 ATACCAGTCTGTGGCCTGTTAGG + Intronic
911101122 1:94096523-94096545 GGACCCGTCTGAGGTCTGCAAGG + Intronic
911134451 1:94424182-94424204 GTAGCTGTCTGTGGTCTGCTAGG + Intronic
911201223 1:95046251-95046273 GTAGCAGTCTGTGGCCTGTTAGG + Intronic
911695087 1:100881866-100881888 GTACTGGTCTGCAGCCTGTTAGG + Intronic
911702271 1:100967446-100967468 GTACTGGTCCATGGTCTGTTAGG - Intronic
913230366 1:116735999-116736021 GTACCGGTCCATGGCCTGTTAGG + Intergenic
913554625 1:119952718-119952740 GTACCTGTGTGTGGCCTGTTAGG - Intronic
914335775 1:146713959-146713981 GTACCAGTTTGTGGCCTGTTAGG + Intergenic
914698569 1:150108897-150108919 ATACCAGTCCGTGGTCTGTTAGG - Intronic
914767356 1:150650474-150650496 GTACTGGTCTGCAGCCTGTTAGG + Intronic
916303572 1:163303692-163303714 GTACCGGTCTGTGGCCTGTTAGG + Intronic
916346465 1:163797332-163797354 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
916619254 1:166477989-166478011 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
916952137 1:169791144-169791166 GTACTGGTCCGTGGCCTGTTAGG - Intronic
917098948 1:171426789-171426811 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
917203423 1:172542456-172542478 GTACTGCTCCGTGGTCTGTTAGG + Intronic
917347919 1:174048024-174048046 GTACTGGTCTGTGGCCTGCTGGG + Intergenic
917543709 1:175940210-175940232 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
917562675 1:176175633-176175655 GTACCAGTCTGTGGCCTATTAGG - Intronic
917752509 1:178066579-178066601 GTACTGGTTTGTGGCCTGTTAGG - Intergenic
917780755 1:178393581-178393603 GTACTGGTCTGTGGCCTGTTAGG - Intronic
918287555 1:183072637-183072659 GTACCAGTCTGTGGCCTGTTAGG + Intronic
918699405 1:187589241-187589263 GTACCTGTCTGTGACCTGTTAGG + Intergenic
918873358 1:190006360-190006382 ATACCTGTCCAAGGTCTGTTAGG + Intergenic
919356304 1:196526904-196526926 GTACCAGTCTGTGACCTGTTAGG + Intronic
919359188 1:196568708-196568730 ATACTGGTCTGTGGCCTGTTAGG - Intronic
919515852 1:198521880-198521902 GTACCTGTCTGTGGCTTGTTAGG + Intergenic
919811544 1:201411951-201411973 GTACCTGTCCGTGGCCTGTTAGG - Intronic
920424747 1:205866146-205866168 GTACTGGTATGTGGCCTGTTAGG - Intergenic
920550378 1:206855666-206855688 GTACCGGTTGGTGGCCTGTTAGG - Intergenic
921016359 1:211195631-211195653 GTACCAGTCCGTGGCCTGTTGGG + Intergenic
921041821 1:211439968-211439990 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
921442737 1:215207170-215207192 GTACTGGTCCATGGTCTGTTAGG + Intronic
921485345 1:215708796-215708818 GTACTGGTCTGTGGCCTGTTGGG - Intronic
921525009 1:216206577-216206599 GTACTGGTCTGTGACCTGTTAGG - Intronic
921964532 1:221074382-221074404 GTACTGGTCTGTGGCCTATTAGG - Intergenic
922031170 1:221800971-221800993 GTACCTGTCTGTGGTCTGTTAGG + Intergenic
922275238 1:224071433-224071455 GTACCGGTCCATGGCCTGTTAGG + Intergenic
922328923 1:224556783-224556805 GTACCGGTCCGTGGCGTGTTAGG - Intronic
922329348 1:224560421-224560443 GTACCACTCTGTGGCCTGTTAGG + Intronic
922329633 1:224562848-224562870 GTATCAGTCTGTGGCCTGTTAGG - Intronic
922501631 1:226101169-226101191 GTACTGGTCCATGGTCTGTTAGG + Intergenic
922781389 1:228255820-228255842 GTACTGTTCTGTGGCCTGTTAGG + Intronic
923616713 1:235544436-235544458 GTATGGGTCTGTGGCCTGTTAGG + Intergenic
923618422 1:235557093-235557115 GTACCAGTCTGTGGCCTGTTAGG - Intronic
923704426 1:236332523-236332545 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
923826130 1:237502718-237502740 GTACCAGTCCGCGGCCTGTTAGG - Intronic
924030180 1:239878511-239878533 GTACCAGTCTGTGGCCTGTTAGG - Intronic
924072722 1:240298501-240298523 GTACCATTCTGTGGCCTGTTAGG + Intronic
924076142 1:240339151-240339173 GTGCTGGTCTGCGGCCTGTTAGG - Intronic
924770387 1:247074832-247074854 GTACCTGTCGGTGGCCTGTTAGG - Intronic
1063283986 10:4662844-4662866 GTACTGGTCCGTGGTCTGTAAGG - Intergenic
1063356364 10:5402614-5402636 GTACCAGTCTGTGCCCTGTTAGG + Intronic
1063536239 10:6886442-6886464 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1064269404 10:13851400-13851422 GTACCAGTCTATGGCCTGTTAGG + Intronic
1064303857 10:14147766-14147788 GTACCAGTCCGTGGCCTGTTAGG - Intronic
1064368195 10:14727232-14727254 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1064473445 10:15661074-15661096 GCACCTGTCTGTGGCCTGTTGGG + Intronic
1064720133 10:18220622-18220644 GTACTGGCTTGTGGTCTGTTAGG + Intronic
1064922909 10:20537785-20537807 GTAGCAGTCTGTGGCCTGTTAGG - Intergenic
1065226519 10:23549093-23549115 GTACTGGTCCATGGTCTGTTAGG + Intergenic
1065284322 10:24173004-24173026 GTACTGGTTTGTGGCCTGTTAGG + Intronic
1065307316 10:24381386-24381408 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1065368397 10:24956775-24956797 GTACCAGCCTGTGGCCTGTTAGG + Intergenic
1065484958 10:26228555-26228577 GTACAGGTCTGCGGTCTATTAGG + Intronic
1065838222 10:29678528-29678550 GTACTGGTTTGTGGCCTGTTTGG - Intronic
1065866809 10:29921526-29921548 GTACCAGTCTGCGATCTGTTAGG + Intergenic
1065959418 10:30722446-30722468 GTATTGGTCTGCGGCCTGTTAGG - Intergenic
1066199537 10:33131815-33131837 GTACCAGTCTGTAGCCTGTTAGG - Intergenic
1066214151 10:33269607-33269629 GTACCAGTTTGTGGTCTGTTAGG + Intronic
1066510763 10:36093108-36093130 ATACAGGTCTGTGGCCTGTTAGG - Intergenic
1066542527 10:36463526-36463548 GTACCTGTCTGTGGTTTGTTAGG + Intergenic
1067092056 10:43272235-43272257 GCACTGGTCTGTGGTCTCTTAGG - Intergenic
1067139227 10:43642432-43642454 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1067160831 10:43823856-43823878 ATACTGGTCTGTGGCCTGTTAGG + Intergenic
1067250951 10:44586916-44586938 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1068017912 10:51541346-51541368 GTACAGGTCTGTGGCCTGTTAGG - Intronic
1068163532 10:53299039-53299061 GTACCAGTCTGTGGCCTGGTAGG - Intergenic
1068250041 10:54426517-54426539 GTACCGTTCCGTGGCCTGTTAGG - Intronic
1068585385 10:58792432-58792454 ATACTGGTCAGTGGTCTGTTAGG + Intronic
1068630067 10:59289289-59289311 GTACCGGCCTGTAGCCTGTTAGG - Intronic
1068651329 10:59526106-59526128 CTACTGGTCTGTGGCCTGTTAGG - Intergenic
1068737555 10:60431481-60431503 GTAGTGGTCTGTGGCCTGTTAGG - Intronic
1068747962 10:60556804-60556826 GCACTGGTCTGTGGCCTGTTAGG + Intronic
1068861759 10:61854931-61854953 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1068929322 10:62573064-62573086 GCACTGGTCTGTGGCCTGTTAGG + Intronic
1068933868 10:62617549-62617571 GAATTGGGCTGAGGTCTGTTTGG + Intronic
1068959195 10:62849642-62849664 GTACTGGTCAGTGGCCTGTTAGG + Intronic
1068970913 10:62957214-62957236 GTACTGGTCTGTGGTCTGTTAGG - Intergenic
1069136469 10:64772915-64772937 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1069154648 10:65012554-65012576 GTACTGGTCAGTGGCCTGTTAGG + Intergenic
1069372236 10:67760585-67760607 GTACCGGTCCGTGGCCTGTTAGG + Intergenic
1069572306 10:69501734-69501756 GTACCGGTCAGTGGCTTGTTAGG + Intronic
1070018498 10:72559777-72559799 GTACTGGTCCGGGGCCTGTTAGG + Intronic
1070048431 10:72862675-72862697 GTACTGGTCAGTGGCCTGTTAGG - Intronic
1070079964 10:73176351-73176373 GTGCTGGTCTGTGGCCTGTTAGG - Intronic
1070842696 10:79498579-79498601 GGACTGGTCTGTGGCCTGTTAGG + Intergenic
1071318595 10:84428468-84428490 GTACCAGTCTGTGGTCTGTTAGG - Intronic
1071380651 10:85056127-85056149 GTAGCGCTCCCAGGTCTGTTAGG + Intergenic
1071686874 10:87767519-87767541 GTACTGGTCTATGGCCTGTTAGG - Intronic
1071850865 10:89569137-89569159 GTAACAGTCTGTGGCCTGTTAGG + Intergenic
1072015694 10:91344210-91344232 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1072056077 10:91757191-91757213 GTACAAGTCAGTGGTCTGTTAGG - Intergenic
1072332729 10:94369469-94369491 GTACCAGTCCGCGGCCTGTTAGG - Intergenic
1072584375 10:96768403-96768425 GTATCAGTCCGTGGTCTGTTAGG - Intergenic
1072884223 10:99259720-99259742 GTATGGGTCTGTGGCCTGTTAGG + Intergenic
1073761771 10:106636760-106636782 GAACAGGTCTGAGTTCTTTTAGG - Intronic
1074124518 10:110517448-110517470 ATACCAGTCAGAGGCCTGTTAGG + Intergenic
1074139608 10:110660437-110660459 GTACCAGGCTGTGGCCTGTTAGG + Intronic
1074507527 10:114084799-114084821 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1074610261 10:115014988-115015010 GTACCAGTCTGTGACCTGTTAGG - Intergenic
1075013235 10:118892504-118892526 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1075237322 10:120742498-120742520 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1075291429 10:121234405-121234427 GTACCGGTCCGTGGCTTGTTAGG - Intergenic
1075301086 10:121324837-121324859 GTACTGGTCCGTGGTCTGTGAGG - Intergenic
1075363798 10:121864449-121864471 GTACTGCTCTGTGGCCTGTTAGG - Intronic
1075606214 10:123812592-123812614 GTACTGGTCTGTTGCCTGTTAGG + Intronic
1075831627 10:125416999-125417021 GTACTGGTCCGCGGCCTGTTAGG + Intergenic
1075913324 10:126145200-126145222 TTACTGGTCTGAGTTCAGTTGGG + Intronic
1076201371 10:128561274-128561296 GTACCAGTCAGTGGCCTGTTAGG - Intergenic
1076621199 10:131789218-131789240 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1078097277 11:8307753-8307775 GTACCAGTCTGTGGTCTGTTAGG + Intergenic
1078116997 11:8463473-8463495 GTACCTGTCCGTGGCCTGTTAGG - Intronic
1078229816 11:9430160-9430182 GTACCGGTCCATGGCCTGTTAGG - Intronic
1078342746 11:10511176-10511198 GTACTGGTCTGCTGCCTGTTAGG + Intergenic
1078625869 11:12957608-12957630 GTACCTGTCGGTGGCCTGTTGGG + Intergenic
1078812659 11:14783886-14783908 GTACCGGTCTGTGGCCTGTTAGG + Intronic
1079405793 11:20144604-20144626 GTACTGGTCTGTGGCCTATTAGG - Intergenic
1079434197 11:20429395-20429417 GTACTGGTCCGTGGCCTGTTAGG - Intronic
1079808972 11:24971428-24971450 GTACTGCTCTGTGGTTTGTTAGG - Intronic
1079870427 11:25792297-25792319 GTACCAGTCTGTGGCCTGTTGGG + Intergenic
1079916582 11:26375337-26375359 GTACTGGTCCATGGTCTGTTAGG - Intronic
1080723617 11:34873050-34873072 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1080878569 11:36298664-36298686 GTACTGGTCTGTGGTCTGTTAGG - Intronic
1080884484 11:36353822-36353844 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1081279182 11:41187402-41187424 CTACTGGTCTGTGGTCTGCTGGG - Intronic
1081294179 11:41365046-41365068 GTACCAGTTTGTGGCCTGTTAGG + Intronic
1081480595 11:43484803-43484825 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1081791232 11:45787612-45787634 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1082740838 11:56909239-56909261 GTGCCAGTCTGTGGTCTGTTAGG - Intergenic
1082769884 11:57199574-57199596 GTACTAGTCTGTGGCCTGTTAGG + Intergenic
1082900489 11:58245039-58245061 GTACTGGTTTGTGGCCTGTTAGG + Intergenic
1083149700 11:60784063-60784085 ATACCAGTCTGTGGCCTGTTAGG + Intergenic
1083282070 11:61633113-61633135 GTACTGGTCTGTGGCCTGTAAGG + Intergenic
1083390460 11:62345948-62345970 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1084242046 11:67828366-67828388 GTAGTGGTCTGTGGCCTGTTAGG - Intergenic
1085009627 11:73129307-73129329 CTAACGGTCTGTGGCCTGTTAGG + Intronic
1085723397 11:78932914-78932936 GTACCGGACCGTGGCCTGTTAGG - Intronic
1086028711 11:82326939-82326961 GTACCAGTCTGAAGCCTGGTTGG - Intergenic
1086486038 11:87303113-87303135 GTACTGGTCCGAGGCCTGTTAGG + Intronic
1086489863 11:87348437-87348459 GTACCGGTCAGTGGTCTGTTAGG + Intergenic
1086616319 11:88824738-88824760 GTACAGGTCTGTGGCCTGTTAGG - Intronic
1087160429 11:94943118-94943140 CTACTGGTCTGTGGCCTGTTAGG - Intergenic
1088205529 11:107387847-107387869 GTACTGGTCTGTGGCCTATTTGG - Intronic
1088341462 11:108772639-108772661 CTACCGGTCTGTGGCCTGTTAGG + Intronic
1088472190 11:110198452-110198474 GTACCGGCGTGTGGCCTGTTAGG + Intronic
1088485022 11:110332369-110332391 GTACTGGTCTGTGGCCTGTTGGG - Intergenic
1089095136 11:115913790-115913812 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1089151109 11:116365033-116365055 GTATCAGTCTATGGTCTGTTAGG + Intergenic
1089512784 11:119011097-119011119 GTACTGGTCTGTGGCCTGTCAGG - Intronic
1089896303 11:121933507-121933529 GTACTGGTAGGTGGTCTGTTAGG - Intergenic
1090122006 11:124039691-124039713 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1090551642 11:127826366-127826388 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1090671269 11:128947331-128947353 GTATGGGTCTGTGGGCTGTTAGG - Intergenic
1090704875 11:129327092-129327114 GTGCTGGTCTGTGGCCTGTTAGG - Intergenic
1090901647 11:131037571-131037593 CTACCGGTCTGTGGCCTGTTAGG - Intergenic
1091513987 12:1159469-1159491 GTGCCGGTCTGTGGCCTGTTAGG - Intronic
1091643781 12:2257617-2257639 GTACCGGTCCATGGCCTGTTAGG - Intronic
1091974415 12:4813028-4813050 GTACTGTTCTGAGATCTTTTGGG + Exonic
1092099489 12:5871445-5871467 GTACCAGTCTGAGGCCTGTCAGG + Intronic
1092194908 12:6543296-6543318 GTACCTGTCTGTGGCCTGTTAGG + Intronic
1092412288 12:8263070-8263092 GTAGTGGTCTGTGGCCTGTTAGG - Intergenic
1092781121 12:11988356-11988378 GTACTGGTCTGTGGCCTATTAGG - Intergenic
1093168200 12:15829513-15829535 GTACCGGTCTGTGGTCTGGTAGG - Intronic
1093832278 12:23776855-23776877 GTACTGGTCCGTGGCCTGTTAGG - Intronic
1093846172 12:23973702-23973724 GCACTGGTCTGTGGCCTGTTAGG + Intergenic
1093886686 12:24469331-24469353 GTACTGGTCCGTGGTCTGTTAGG - Intergenic
1094053929 12:26249511-26249533 GTACAGGTCCTAGGCCTGTTAGG - Intronic
1094066184 12:26363032-26363054 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1094075157 12:26464513-26464535 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1094546877 12:31412630-31412652 GTACTGGTCTGTGGTCTGTTAGG - Intronic
1094689182 12:32751869-32751891 GTACCAGTCCGTGGCCTGTTAGG - Intronic
1094695831 12:32817819-32817841 GTACCAGTCCGTGGACTGTTAGG + Intronic
1095177594 12:39111097-39111119 CTACCAGTCTGTGGCCTGTTAGG + Intergenic
1095178965 12:39124997-39125019 ATACTGGTCTGTGGCCTGTTAGG - Intergenic
1095183580 12:39175248-39175270 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
1095184097 12:39180699-39180721 GTACCAGTCTATGGCCTGTTAGG - Intergenic
1095322686 12:40848068-40848090 GTATGGGTCTGTGGCCTGTTAGG - Intronic
1095457259 12:42401453-42401475 CTACTGGTCTGTGGCCTGTTAGG + Intronic
1095654332 12:44650976-44650998 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1095695828 12:45143013-45143035 GGACCAGTCTGTGGCCTGTTAGG - Intergenic
1095764288 12:45877176-45877198 GTACTGGTCCGTGGCCTGTTAGG + Intronic
1095811335 12:46375343-46375365 GTACCAGTCTGAAGCCTGTTAGG + Intergenic
1095914831 12:47467243-47467265 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1096184904 12:49572548-49572570 GTACTGGGCTGTGGCCTGTTGGG - Intronic
1096341110 12:50800498-50800520 GTACCTGTCTGTGGCCTATTAGG + Intronic
1096431712 12:51549745-51549767 GTACCTGTCTGTGGCCTGTTAGG + Intergenic
1097809939 12:64007511-64007533 GTACCAGTCCGTGGCCTGTTAGG - Intronic
1098157266 12:67612582-67612604 GTACTGGTCAGTGGCCTGTTAGG + Intergenic
1098170456 12:67741787-67741809 GTGCAGGTCTGTGGCCTGTTAGG + Intergenic
1098486530 12:71028012-71028034 GTACCAGTCCCTGGTCTGTTAGG + Intergenic
1098937091 12:76492457-76492479 ATACGGGTCTGTGGCCTGTTAGG + Intronic
1099012098 12:77303479-77303501 GTACTGGTTTGTGGTCTGTTAGG + Intergenic
1099025061 12:77455090-77455112 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
1099195294 12:79608525-79608547 CTACCTGTCTGTGGCCTGTTAGG - Intronic
1099317775 12:81106104-81106126 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1099338615 12:81397716-81397738 GTACTGGTCTGTGGCCTGTTTGG + Intronic
1099380725 12:81949176-81949198 GTCCCGGTCTGAGTTCTTGTGGG - Intergenic
1099871613 12:88356475-88356497 GTACCAGTCTGTGGCCTATTAGG + Intergenic
1099974702 12:89534177-89534199 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1100162131 12:91872707-91872729 GTACCAGTCTATGGACTGTTAGG + Intergenic
1100230823 12:92605252-92605274 GTACCAGTCTATGGCCTGTTAGG + Intergenic
1100456863 12:94760129-94760151 GTACCGATCTGTGGCCTGTTAGG - Intergenic
1100506417 12:95225063-95225085 GTACCGGTCCATGGCCTGTTAGG - Intronic
1100547823 12:95620200-95620222 GTACCGGTCTGTGGTCTGTTAGG - Intergenic
1100553638 12:95671350-95671372 GTACTGGTTTGTGGCCTGTTAGG + Intronic
1100852684 12:98729537-98729559 GTACTGGTCTGTGGCCTTTTAGG - Intronic
1100986124 12:100203202-100203224 GTACCTGTCTGTGGTCTGTTGGG - Intronic
1101159248 12:101956550-101956572 GTACTGGTCCGTGGCCTGTTAGG - Intronic
1101374214 12:104157011-104157033 GTACCAGCCTGTGGCCTGTTAGG - Intergenic
1101470517 12:104992620-104992642 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1101635504 12:106537372-106537394 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1101649340 12:106660685-106660707 GTACTAGTCTGTGGTCTGTTAGG + Intronic
1101658095 12:106742015-106742037 GTACCGGACCGTGGCCTGTTAGG - Intronic
1101676957 12:106926008-106926030 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
1101741357 12:107502615-107502637 GTACAGGTCTGTGGCCTGTTAGG + Intronic
1101931416 12:109017121-109017143 GTAACGGTCTCTGGCCTGTTAGG + Intronic
1101976708 12:109365839-109365861 GTACCGGTCCGTGGCCTGTTAGG + Intronic
1102338621 12:112103992-112104014 ATACTGGTCTGTGGCCTGTTAGG - Intronic
1102431397 12:112886570-112886592 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1102601732 12:114036626-114036648 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1102751287 12:115296847-115296869 GTACTGGTCTGTGGCCTCTTAGG - Intergenic
1103161350 12:118731896-118731918 GTACCAGTCTGTGGTCTGTTAGG + Intergenic
1103237639 12:119386589-119386611 GTAGCCGTCTGAGGGCTGCTGGG + Intronic
1103338261 12:120206440-120206462 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1103626310 12:122222893-122222915 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1103865343 12:124047321-124047343 GTACCTGTCTTTGGCCTGTTAGG + Intronic
1104068380 12:125324522-125324544 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1104246815 12:127050989-127051011 GTACCAGTTTGTGGCCTGTTAGG + Intergenic
1104361236 12:128135242-128135264 GTATCAGCCTGAGGCCTGTTAGG + Intergenic
1104538478 12:129640713-129640735 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1104617876 12:130285502-130285524 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
1104650660 12:130529962-130529984 GCACAGGTCTGTGGCCTGTTAGG - Intronic
1105064253 12:133182930-133182952 GTACCAGTCTGTGGTCTGTTAGG + Intronic
1105447184 13:20467840-20467862 GTACCGGTCCCTGGCCTGTTAGG + Intronic
1106457151 13:29937437-29937459 GTCCCAGTCTGTGGCCTGTTAGG + Intergenic
1106623571 13:31395472-31395494 GTACTGGGCTGTAGTCTGTTAGG - Intergenic
1106658313 13:31771258-31771280 GTACCAGTCTGTGGCATGTTAGG + Intronic
1106832742 13:33602646-33602668 GGACCGGTCTGTGGCCTGTTAGG + Intergenic
1106975258 13:35204020-35204042 GTACCGGTCTGTGGCCTGTCAGG + Intronic
1107441727 13:40433750-40433772 GTACTGGTCTGTGGTTTGTTAGG + Intergenic
1107446186 13:40472080-40472102 GTACCAGTATGTGGCCTGTTAGG + Intergenic
1107515773 13:41127446-41127468 GTACCAGTCTGTGGCCTGTTTGG - Intergenic
1108097667 13:46921126-46921148 ATACTGGTCTGTGGCCTGTTAGG + Intergenic
1108320132 13:49281635-49281657 GTACTGGTCCGTGGCCTGTTAGG - Intronic
1108457857 13:50634603-50634625 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1108476692 13:50826249-50826271 GAACTGGTCTGTGGCCTGTTAGG - Intronic
1108608211 13:52061337-52061359 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1108647090 13:52441101-52441123 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1108747587 13:53410471-53410493 GTACTGGTTTGTGGCCTGTTAGG - Intergenic
1108837557 13:54570900-54570922 GTACTCGTCTGTGGCCTGTTAGG - Intergenic
1109078550 13:57868193-57868215 ATACTGGTCTGTGGCCTGTTAGG - Intergenic
1109282261 13:60370594-60370616 GTACCAGTCTGTGTCCTGTTAGG - Intergenic
1109882895 13:68504612-68504634 GTATCAGTCTGTGCTCTGTTAGG - Intergenic
1109973378 13:69799814-69799836 GTAATGGTCCGTGGTCTGTTAGG + Intronic
1109990508 13:70048816-70048838 GTACTGGTCCATGGTCTGTTAGG - Intronic
1110406987 13:75161966-75161988 GTACTGGTCTGTGGCTTGTTAGG + Intergenic
1110763034 13:79251675-79251697 GTACCGGTCTGTGACTTGTTAGG - Intergenic
1111070609 13:83161118-83161140 GTACTGGTCTGAGGCTTATTAGG + Intergenic
1111592686 13:90370389-90370411 GTACGGGTCTGTGGCCTGTTAGG - Intergenic
1112033000 13:95474429-95474451 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1112561918 13:100522716-100522738 CTAATGGGCTGAGGTCTGTTTGG - Intronic
1112887819 13:104195039-104195061 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1112939258 13:104841259-104841281 GTTCTGGTCTGTGGCCTGTTAGG + Intergenic
1113122745 13:106942003-106942025 GTACCGGTCCATGGTCTGTTAGG - Intergenic
1113472365 13:110556048-110556070 GCACCTGTCTGAGCTTTGTTAGG - Intronic
1113973365 13:114207679-114207701 ATACCAGTCTGTGGCCTGTTAGG - Intergenic
1114274086 14:21125986-21126008 GTACCAGTCGGTGGCCTGTTAGG + Intergenic
1114373290 14:22113649-22113671 GTACCATTCTGTGGCCTGTTAGG - Intergenic
1114581987 14:23769553-23769575 GTACTGGTCTAATGCCTGTTAGG - Intergenic
1115035639 14:28853419-28853441 GTGCTGGTCTGTGGTCTGTTAGG + Intergenic
1115332045 14:32208382-32208404 GTACCTGTCTGTGACCTGTTCGG + Intergenic
1115735982 14:36330677-36330699 GTACTGGTCTGTGACCTGTTAGG + Intergenic
1115787550 14:36843147-36843169 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1115955789 14:38777576-38777598 GTACCAGTTTGTGGCCTGTTAGG - Intergenic
1116028092 14:39537980-39538002 TTCCCAGTCTGAGGGCTGTTAGG - Intergenic
1116276034 14:42832806-42832828 TTAGCGGTCTGTGGCCTGTTAGG - Intergenic
1116823883 14:49652427-49652449 GTACCAGTCCATGGTCTGTTAGG + Intronic
1117240270 14:53825169-53825191 GTACGAGTCTGTGGCCTGTTAGG + Intergenic
1117493601 14:56277161-56277183 GTAGTGGTCTGTGGCCTGTTTGG + Intronic
1117554405 14:56869830-56869852 GTGCCAGTCTGTGGCCTGTTAGG + Intergenic
1117574967 14:57088513-57088535 ATACCAGTCTGTGGCCTGTTAGG + Intergenic
1117630376 14:57684584-57684606 GTACTGTTCTGTGGCCTGTTAGG - Intronic
1117706495 14:58475136-58475158 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1117767790 14:59100895-59100917 GTACCGGATTGTGGACTGTTAGG - Intergenic
1117827056 14:59714808-59714830 GTACTGGTCCGTGGTCTGTTAGG + Intronic
1118142090 14:63095080-63095102 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1118620769 14:67612191-67612213 GTACTGGCCTGTGGCCTGTTAGG - Intergenic
1118762415 14:68888622-68888644 GTACTGGTCCGTGGCCTGTTAGG + Intronic
1118943082 14:70356434-70356456 GTACTGGTTTGTGGCCTGTTAGG - Intronic
1119062080 14:71485306-71485328 GTACCAGTCTGTGGCCTCTTGGG + Intronic
1119121607 14:72084358-72084380 CTACCAGTCTGTGGCCTGTTAGG - Intronic
1120464784 14:84842589-84842611 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1120558217 14:85956690-85956712 GTACCAGTCTGCAGCCTGTTAGG + Intergenic
1120880370 14:89411007-89411029 GTACCAATCAGTGGTCTGTTAGG + Intronic
1121063697 14:90940709-90940731 GTACTGGTCTGCGGCCTGTTAGG + Intronic
1121149179 14:91615121-91615143 GTACCAGTCTGTGGACTGTTAGG + Intronic
1121497077 14:94400208-94400230 GTACCGGTCCTTGGCCTGTTAGG - Intergenic
1121500909 14:94436689-94436711 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1122472662 14:101981995-101982017 GTACTGGTCCGCGGCCTGTTGGG + Intronic
1122833631 14:104420034-104420056 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1122833695 14:104420658-104420680 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1124788434 15:32703627-32703649 ATACTGGTCTGTGGTCTGTTAGG + Intergenic
1124917822 15:33994088-33994110 GTACCGGTCTGTGGCTTGTTAGG + Intronic
1125249054 15:37678347-37678369 GTGCCAGTCTGTGGCCTGTTAGG - Intergenic
1125375868 15:39028821-39028843 CTACCGGTCTGTGGCCTGTTAGG + Intergenic
1125499742 15:40232219-40232241 GTACTGGTCTGTGGCCTGATAGG - Intergenic
1125643538 15:41251492-41251514 GTACCAGTCTGTGGCCAGTTAGG + Intronic
1125750205 15:42022771-42022793 GTACCAGTCCGTGGCCTGTTTGG - Intronic
1125752578 15:42038640-42038662 GTACTGGTCTGTGGCCTGCTAGG - Intronic
1125860721 15:42997002-42997024 GTACCAGTCTATGGCCTGTTGGG + Intronic
1125936847 15:43644523-43644545 GTACCAGTCCATGGTCTGTTAGG + Intronic
1125949655 15:43741310-43741332 GTACCAGTCCATGGTCTGTTAGG + Intergenic
1126344384 15:47677147-47677169 GTACCAGTCTGTAGCCTGTTAGG - Intronic
1126457021 15:48874379-48874401 GTACCAGTCCGTGGCCTGTTAGG + Intronic
1126646883 15:50883601-50883623 GTACCGGTCCCTGGCCTGTTAGG + Intergenic
1126911511 15:53422004-53422026 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1127008563 15:54597239-54597261 ATACCGGTCTGTGGCCTGTTAGG - Intronic
1127379065 15:58413360-58413382 GTACCAGTGTGTGGCCTGTTAGG + Intronic
1127459274 15:59183102-59183124 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1127794511 15:62426527-62426549 GGACCAGGCTGAGGTCTGTCTGG - Intronic
1127809503 15:62551265-62551287 GTACCAGTCTGTGCCCTGTTAGG - Intronic
1127901054 15:63341291-63341313 GTACCGGTCTGTGGCCTGTTAGG + Intronic
1128089450 15:64909531-64909553 GTACTGGTCTATGGCCTGTTAGG - Intronic
1128230567 15:66031884-66031906 GTACTGGTCTGTAGCCTGTTAGG + Intronic
1129007342 15:72384872-72384894 GTACTGGTCTGTGGTCTATTAGG + Intergenic
1129779574 15:78261528-78261550 GTACTGGTCTGTGGCCTGTCAGG + Intergenic
1129985079 15:79911905-79911927 GTACCAGTCAGCGGCCTGTTAGG + Intronic
1130076109 15:80691920-80691942 GTACTGGTCAGTGGCCTGTTAGG + Intronic
1130781036 15:87041637-87041659 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1130918895 15:88327594-88327616 GTACCAGTCCGTGGCCTGTTGGG - Intergenic
1131488699 15:92843429-92843451 GTGCTGGTCTGTGGCCTGTTAGG + Intergenic
1131565686 15:93483428-93483450 GTACCAGTCCGTGGCCTGTTTGG + Intergenic
1131810580 15:96169045-96169067 GTACCAATCTGTGGCCTGTTAGG + Intergenic
1132033360 15:98457539-98457561 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1132344112 15:101097406-101097428 GTCCTGGTCTGTGGCCTGTTAGG - Intergenic
1133119987 16:3600307-3600329 GTACCGGTCTGTGGCCTGTTAGG - Intronic
1133353555 16:5119296-5119318 GTAGTGGTCTGTGGCCTGTTAGG - Intergenic
1133586686 16:7202536-7202558 GTACCGGTGTATGGCCTGTTAGG + Intronic
1133620971 16:7525974-7525996 GTACTGGTCTGTAGCCTGTTGGG + Intronic
1133967957 16:10545361-10545383 GTACCTGTCTGTAGCCTGTTAGG + Intronic
1134583437 16:15391038-15391060 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1134586378 16:15414854-15414876 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1134689245 16:16180221-16180243 GCACCAGTCTGTGGCCTGTTAGG - Intronic
1135127658 16:19824462-19824484 GTACCGGTCCATGGCCTGTTAGG - Intronic
1135284561 16:21182211-21182233 GTACCGGTCCTTGGCCTGTTAGG + Intergenic
1135300330 16:21321257-21321279 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1135314927 16:21436473-21436495 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1135367853 16:21868741-21868763 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1135443964 16:22502408-22502430 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1135449478 16:22545008-22545030 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1136013684 16:27381576-27381598 GTGCCCATCAGAGGTCTGTTGGG + Intergenic
1136060939 16:27726008-27726030 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1136192843 16:28628324-28628346 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1136311597 16:29415134-29415156 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1136325040 16:29516929-29516951 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1136439725 16:30256913-30256935 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1136674259 16:31886319-31886341 GTACTGGTCTGTGGCCTGTGAGG + Intronic
1136929891 16:34409574-34409596 GTACTGGCCTGTGGCCTGTTAGG - Intergenic
1136974683 16:35002231-35002253 GTACTGGCCTGTGGCCTGTTAGG + Intergenic
1137714156 16:50587736-50587758 GTACAGGTCTGTGGCCTATTAGG + Intronic
1137836642 16:51598451-51598473 GTACCAGTCTGTGGCCTCTTAGG - Intergenic
1138146720 16:54619285-54619307 CTACTGGTCTGTGGTCTGTTAGG - Intergenic
1138313696 16:56050142-56050164 GTACCGGTTTGTGGCCTGTTAGG + Intergenic
1138694818 16:58803275-58803297 GTACTGGCCAGTGGTCTGTTAGG + Intergenic
1138708471 16:58941995-58942017 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1139305860 16:65985926-65985948 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1139375081 16:66491874-66491896 GTACTGGTCTATGGTCTGTTAGG - Intronic
1139727833 16:68916207-68916229 GTACTGTTCTGTGGCCTGTTAGG + Intronic
1139859123 16:70006177-70006199 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1139886229 16:70209210-70209232 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1139997849 16:70997269-70997291 GTACCAGTTTGTGGCCTGTTAGG - Intronic
1140149605 16:72348880-72348902 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1140338700 16:74136462-74136484 GTACCAGTCTGTGGCTTGTTAGG - Intergenic
1140418661 16:74797552-74797574 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1140672625 16:77293901-77293923 GTACCTGTTTGTGGTCTGTAAGG - Intronic
1140688051 16:77452525-77452547 GTACCTGTCTGTGATCTGTTAGG - Intergenic
1140725521 16:77808047-77808069 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1140920338 16:79531795-79531817 GTACCAGTCTGTGGCCTCTTAGG - Intergenic
1141107108 16:81242763-81242785 GTACCAGTCTGTAGCCTGTTAGG + Intronic
1141216090 16:82025179-82025201 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1141327772 16:83078577-83078599 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1141876917 16:86831528-86831550 GTACTGGTCTGTGGGCTGTTAGG + Intergenic
1143602061 17:7953632-7953654 GTAGCGGTCTGTGGACTGTTTGG - Intergenic
1143796619 17:9342271-9342293 GTACCGGTCTGTGGCCTTTTAGG - Intronic
1144018353 17:11218783-11218805 GTACTGGTCCGAGGCCTGTTAGG + Intergenic
1144427878 17:15161569-15161591 GTACTGGTCTGTGACCTGTTAGG - Intergenic
1144450182 17:15370611-15370633 GTACCGGTCTGCAGCCTGTTAGG - Intergenic
1144523892 17:15973484-15973506 GTACTGGTCCGTGGCCTGTTAGG + Intronic
1144557870 17:16297870-16297892 GTACAGGTCCGTGGCCTGTTAGG + Intronic
1144584484 17:16479904-16479926 GTACCAGTCTGTGACCTGTTAGG + Intronic
1144614042 17:16752081-16752103 GTACTGGTCTGTGACCTGTTAGG + Intronic
1144865351 17:18332098-18332120 GTACTGGTTTGTGGTCTGTTAGG - Intronic
1144898668 17:18563586-18563608 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1145133707 17:20382133-20382155 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1146421975 17:32695374-32695396 GTACTGGACTGTGGCCTGTTAGG - Intronic
1146422431 17:32700414-32700436 GTACTGGTCCGTGGCCTGTTAGG - Intronic
1146689364 17:34862531-34862553 GTACCAGTCTGTTGCCTGTTAGG + Intergenic
1146738087 17:35256857-35256879 GTACCTGACTGTGGCCTGTTAGG + Intronic
1147412435 17:40263422-40263444 GTACAGGTCAGTGGCCTGTTAGG - Intronic
1147686861 17:42291339-42291361 GTACAGGTCGGTGGTCTGTTAGG - Intronic
1149025921 17:52027334-52027356 ATACCAGTCAGAGGCCTGTTAGG - Intronic
1149290676 17:55215135-55215157 GTACTGGTCCGTGGTCTGTTAGG - Intergenic
1149314680 17:55427889-55427911 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1149440286 17:56668050-56668072 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1149588255 17:57808096-57808118 GTACCAGTCAGTGGCCTGTTAGG + Intergenic
1150498263 17:65625822-65625844 GTACTGGTGTGTGGCCTGTTAGG + Intronic
1150517110 17:65825429-65825451 GTACCTGTCTGTGGCCTGTTAGG - Intronic
1151263654 17:72936969-72936991 GTATGGGTCTGTGGCCTGTTAGG - Intronic
1151279559 17:73063000-73063022 TTACTGGTCTGTGGCCTGTTAGG - Intronic
1151331621 17:73413045-73413067 GTACCAGTCTGTGGTCTGTTAGG + Intronic
1151413407 17:73946130-73946152 GTCCCAGTCTGTGGCCTGTTAGG + Intergenic
1151442339 17:74138511-74138533 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1151629624 17:75301635-75301657 GTACGGGTCTGTGGCCTGTAAGG + Intergenic
1151881088 17:76894982-76895004 GTACCGCTCCATGGTCTGTTAGG + Intronic
1151984051 17:77530632-77530654 GTACCGGTCTGTGGCCCTTTAGG - Intergenic
1152414517 17:80150604-80150626 GCACCTGTCTGTGGCCTGTTAGG + Intergenic
1152851959 17:82642171-82642193 GTACTGGTCCGTGGCCTGTTAGG + Intronic
1153342365 18:3988697-3988719 GTACGGGTCCGTGGCCTGTTAGG - Intronic
1153386594 18:4504649-4504671 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
1153947767 18:10032384-10032406 GTGACAGCCTGAGGTCTGTTCGG + Intergenic
1154226662 18:12511239-12511261 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1154488446 18:14898500-14898522 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
1155263399 18:24067429-24067451 GTACTGGTCTATGGGCTGTTAGG + Intronic
1155401826 18:25447795-25447817 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1155460001 18:26068103-26068125 ATACGGGTCTGTGGCCTGTTAGG - Intronic
1155612520 18:27682878-27682900 GTACCAGTCTGTGGCTTGTTAGG - Intergenic
1155759637 18:29549616-29549638 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1155908329 18:31479025-31479047 GTACCTGTCTGTGGCCTGTTAGG - Intergenic
1156360639 18:36381574-36381596 GTCCTGGTCTGAGCTCTGTGAGG + Intronic
1157209946 18:45733756-45733778 GTACCTGTCTGTGGCCTGTTGGG + Intronic
1157409896 18:47454821-47454843 GTAGCGGTCTGTGGCTTGTTAGG - Intergenic
1157904600 18:51558326-51558348 GTACTGGTCTGTGGCCTCTTAGG + Intergenic
1157986856 18:52448054-52448076 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1158133863 18:54184203-54184225 GTAGCGGTCTGTGGCCTGTTGGG + Intronic
1158197563 18:54905740-54905762 GTACCAGTCTATGGCCTGTTAGG + Intronic
1158216095 18:55102313-55102335 ATACTGGTCTGTGGCCTGTTAGG - Intergenic
1158285303 18:55874142-55874164 GTACCTGTCTGTGGCCCGTTAGG - Intergenic
1158289544 18:55923808-55923830 GTGCTGGTCTGTGGCCTGTTAGG - Intergenic
1158403318 18:57140262-57140284 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1158584377 18:58718375-58718397 GAACTGGTCTGTGGCCTGTTAGG + Intronic
1158595998 18:58816558-58816580 GTACCGGTCTGTGGCCTGTTAGG - Intergenic
1158684402 18:59600131-59600153 GGACAGGTCTGTGGCCTGTTAGG + Intronic
1158909523 18:62046326-62046348 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1159021805 18:63149418-63149440 GTATGGGTCTGTGGCCTGTTAGG - Intronic
1159031164 18:63233688-63233710 GTACAGGTCCGTGGCCTGTTAGG - Intronic
1159256556 18:65954658-65954680 GTACTGATCTGTGGCCTGTTAGG - Intergenic
1159285371 18:66342823-66342845 GTACCAGTCTGCAGCCTGTTAGG - Intergenic
1159342917 18:67160340-67160362 GTGCTGGTCTGTGGCCTGTTAGG - Intergenic
1160606792 18:80057693-80057715 GTACCCATCTGTGGCCTGTTAGG + Intronic
1161862352 19:6807556-6807578 GTACCGGTCCATGGTCTGTTAGG - Intronic
1162037458 19:7949440-7949462 GTACCTGTCTGTGGCCTGTTAGG - Intergenic
1162259862 19:9523861-9523883 GTACTGGTCTGTGGCCTGCTAGG - Intergenic
1162684491 19:12370452-12370474 GTACCAGACTGTGGCCTGTTAGG - Intergenic
1162750621 19:12827093-12827115 CTAATGGTCTGAGGTCTGTAGGG - Intronic
1163223531 19:15938759-15938781 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1163372771 19:16911138-16911160 GTACCGGTTGGTGGCCTGTTAGG + Intronic
1163616834 19:18334149-18334171 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1164677041 19:30107784-30107806 GTAAAAGTCTGAGGGCTGTTTGG - Intergenic
1165252046 19:34546748-34546770 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1165358034 19:35316003-35316025 ATACTGGTCTGTGGCCTGTTAGG + Intergenic
1165410452 19:35657460-35657482 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1165479161 19:36051797-36051819 GTACCAGTCTATGGCCTGTTAGG + Intronic
1165683996 19:37802323-37802345 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1165779219 19:38422453-38422475 GTACCAGTCCGTGGCCTGTTAGG + Intronic
1166526103 19:43510809-43510831 GTACCGGTCCGTGGTCTGTTAGG + Intronic
1166582590 19:43915538-43915560 GTACCAGTCCGTGGCCTGTTAGG + Intronic
1166612852 19:44214855-44214877 GTACTAGTCTGTGGCCTGTTAGG + Intronic
1167802435 19:51753209-51753231 ATACCGGTCTGTGGCCTGTTAGG + Intronic
1167986770 19:53325024-53325046 GTACCAGTCTATGGCCTGTTAGG + Intergenic
1168384639 19:55952997-55953019 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1168568721 19:57446129-57446151 GTACCAGTCTGTGGCCTGTTAGG + Intronic
925029589 2:639186-639208 GTACCAGCCTGTGGCCTGTTAGG - Intergenic
925103830 2:1272437-1272459 GTACCAGTCTGTGGCCTGTTAGG - Intronic
925445641 2:3924522-3924544 GTACTGATCTGTGGCCTGTTAGG - Intergenic
925666970 2:6268138-6268160 GTAACAGTCTGTGGCCTGTTAGG + Intergenic
925744237 2:7031131-7031153 GTAGCGGTCTGTAGCCTGTTAGG - Intronic
925825252 2:7841974-7841996 GTACCAGTCTGTAGCCTGTTAGG - Intergenic
925926485 2:8674922-8674944 GTACCGGTCTGTGACCTGTTAGG + Intergenic
926176477 2:10596664-10596686 GTACTGGTCTGGGGCCTTTTAGG - Intronic
926236130 2:11045454-11045476 GTCCTGGTCTGTGGCCTGTTAGG - Intergenic
926562205 2:14430148-14430170 GTACCAGTCTTTGGCCTGTTAGG + Intergenic
926669007 2:15558276-15558298 GTACCAGTCTGTGGTCTGTTAGG - Intronic
926701500 2:15807193-15807215 GTACCGATTTGGGGCCTGTTAGG + Intergenic
926930738 2:18038035-18038057 GTACTGGTATGTGGCCTGTTAGG - Intronic
927204462 2:20598514-20598536 GTACCGGTCCCTGGCCTGTTAGG - Intronic
927259493 2:21072708-21072730 GTACCACTCTCTGGTCTGTTAGG - Intergenic
927339573 2:21966881-21966903 GTACTGGTTTGTGGCCTGTTAGG - Intergenic
927587233 2:24318826-24318848 GCACTGGTCTGTGGCCTGTTAGG + Intronic
928641459 2:33303823-33303845 GTACGGGTCCGTGGCCTGTTAGG - Intronic
928711991 2:34017658-34017680 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
929239897 2:39643255-39643277 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
929675123 2:43919000-43919022 GTACTGGTCCGTGGTCTGTTAGG + Intronic
929797805 2:45073449-45073471 GATCCTGTCTTAGGTCTGTTGGG + Intergenic
929895896 2:45960652-45960674 GTACTGGTCTGTGGCCTGTTAGG - Intronic
930306946 2:49686495-49686517 GTACTGGTCTGTAGCCTGTTAGG - Intergenic
930317684 2:49817332-49817354 GTACTGGTCTGTGGCTTGTTAGG + Intergenic
930649766 2:53952848-53952870 GTATGGGTCTGTGGCCTGTTAGG - Intronic
930797146 2:55405579-55405601 GTACAGGTCTGTGCCCTGTTAGG + Intronic
931011141 2:57915755-57915777 GTACCGGTTTGTGGCCTGTTAGG + Intronic
931389884 2:61832584-61832606 GTACGGGTCTGTGGCCTGTTAGG + Intronic
931489015 2:62724712-62724734 GTACCAGTCTATGGCCTGTTGGG + Intronic
931495691 2:62804717-62804739 GTACTGGTCCGTGGCCTGTTAGG + Intronic
932054343 2:68429604-68429626 GTACCAGTCTATGGCCTGTTAGG + Intergenic
932206634 2:69889228-69889250 GTATGGGTCTGTGGCCTGTTAGG - Intergenic
933224165 2:79726354-79726376 GTACCTGTCCGTGGCCTGTTAGG + Intronic
933845518 2:86323401-86323423 AGACTGGTCTGTGGTCTGTTAGG + Intronic
933888217 2:86740027-86740049 GTACCCCTCTGTGGCCTGTTAGG + Intronic
933921961 2:87056679-87056701 GTACCCCTCTGTGGCCTGTTAGG - Intergenic
934569902 2:95362772-95362794 GTACTAGTCGGTGGTCTGTTAGG - Intronic
934613614 2:95758094-95758116 GTAAGGGGCTCAGGTCTGTTGGG - Intergenic
934876098 2:97922299-97922321 GTACCGGTCTGTGGCCTGTTAGG - Intronic
934885805 2:98023276-98023298 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
934941968 2:98509238-98509260 GTACTGGCCTGTGGCCTGTTAGG + Intronic
935002371 2:99031648-99031670 CTACCAGTCTGTGGTCTGTTAGG + Intronic
935433093 2:102999152-102999174 GTACCAGTCCGTGGCCTGTTGGG + Intergenic
935565205 2:104598941-104598963 GTACTGGTCTGTGGTCTGTTAGG - Intergenic
935682622 2:105651297-105651319 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
935725671 2:106021816-106021838 GTACCAATCTGTGGCCTGTTAGG + Intergenic
935762251 2:106332129-106332151 GTAGCAGTCTGTGGTCTGTTAGG + Intergenic
935804304 2:106730986-106731008 GTACCAGTCTGTGGCCTATTAGG + Intergenic
935810449 2:106792242-106792264 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
936034505 2:109100198-109100220 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
937381051 2:121376644-121376666 GTATTGGTCTGTGGCCTGTTAGG + Intronic
937421497 2:121760040-121760062 GTACTGGTCTGTGGCCTGTTAGG + Intronic
938054968 2:128208108-128208130 GTACGGGTCTCTGGCCTGTTAGG - Intergenic
938334675 2:130481476-130481498 GTACCAGTCCACGGTCTGTTAGG + Intronic
938355146 2:130639194-130639216 GTACCAGTCCACGGTCTGTTAGG - Intronic
938431574 2:131245982-131246004 GTACCAGTCCACGGTCTGTTAGG - Intronic
938552922 2:132397296-132397318 GGACTGGTCTGTGGCCTGTTAGG - Intergenic
938630455 2:133160959-133160981 GTAGCAGTCTGTGGCCTGTTAGG + Intronic
938684189 2:133720974-133720996 GTACCAGTCTGTGGCTTGTTAGG - Intergenic
939034023 2:137109795-137109817 GTACTGGTCAGCGGCCTGTTAGG - Intronic
939658144 2:144853077-144853099 GTACCAGTCTGTGGCCTGGTAGG + Intergenic
940293785 2:152101680-152101702 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
940375130 2:152949074-152949096 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
940428020 2:153552991-153553013 ATACCAGTCTGTGGTCTGTTAGG - Intergenic
940430102 2:153579654-153579676 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
940623896 2:156148860-156148882 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
941075967 2:161007131-161007153 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
941398691 2:165003822-165003844 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
941676237 2:168346095-168346117 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
941785004 2:169488582-169488604 GTACTGGTCAGTGGCCTGTTAGG - Intronic
942029202 2:171941782-171941804 GTATCGGTTTGTGGCCTGTTAGG - Intronic
942052741 2:172155824-172155846 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
942104904 2:172624290-172624312 GTACCAGTCTGTGGCCTGTAAGG + Intergenic
942338817 2:174921150-174921172 GTACCACTCTGTGGCCTGTTAGG - Intronic
942479469 2:176368462-176368484 GTACTGGTCTGTGGCCTATTAGG + Intergenic
942840044 2:180349209-180349231 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
942944801 2:181660293-181660315 GTACCTGTCTGTGGCCTGTTTGG - Intronic
943058929 2:183017618-183017640 GTACCAGTCCGTGGCCTGTTAGG - Intronic
943502179 2:188705909-188705931 CTATCAGTCTGTGGTCTGTTAGG + Intergenic
943618452 2:190120066-190120088 GTACCAGTCCGTGGCCTGTTAGG + Intronic
943742986 2:191431272-191431294 GTACCGGTCTATGGCCTGTTAGG + Intergenic
943776539 2:191772696-191772718 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
943871038 2:192999575-192999597 GTACTGGTCTCTGGCCTGTTAGG - Intergenic
944237956 2:197457207-197457229 GTACCTGTCCGTGGCCTGTTAGG - Intronic
944311605 2:198239909-198239931 GTACCAGTCTGTGGCCTGTTAGG + Intronic
944445701 2:199786115-199786137 GTACTGGTCTGTGGCCTGTTAGG - Intronic
944870980 2:203911557-203911579 GTACCAGTCTGAGGCCTATTAGG - Intergenic
944896194 2:204167779-204167801 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
945027311 2:205631419-205631441 GAACCGGTCTGTGGCCTGTTAGG - Intergenic
945149816 2:206778703-206778725 GTACCAGTCCGTGGCCTGTTAGG + Intronic
945446304 2:209942079-209942101 GTACTGGTCTGTGGCCTGTAAGG + Intronic
945526593 2:210895386-210895408 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
945635237 2:212340761-212340783 GGACCAGTCTATGGTCTGTTAGG - Intronic
945671638 2:212809378-212809400 GTACTGGTCAGTGGCCTGTTAGG + Intergenic
946078383 2:217095172-217095194 GTACGGGTCTGTGGCCTGTTAGG - Intergenic
946473655 2:219986872-219986894 GTATCAGTCTGTGGCCTGTTTGG + Intergenic
946779308 2:223176564-223176586 GTACCGGTCTGTGGCCTGTTAGG + Intronic
946867726 2:224057738-224057760 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
947208350 2:227682963-227682985 GTACTGGTCGGTGGCCTGTTAGG - Intergenic
947218726 2:227772511-227772533 GTACCAGTCTGTGGCCTGCTGGG + Intergenic
947321371 2:228922804-228922826 GTACTGGTCCGTGGCCTGTTAGG - Intronic
947685696 2:232082344-232082366 GTACTGGTCTGTGGCCTGTTAGG + Intronic
948165357 2:235857104-235857126 GTACCAGTCTGTGGCCTGTTAGG + Intronic
948250135 2:236520904-236520926 GTACCGGTCCGTGGCCTGTTAGG - Intergenic
948330190 2:237158426-237158448 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
948516338 2:238506069-238506091 GTACCCGACTGTGGCCTGTTAGG - Intergenic
948535740 2:238645240-238645262 GTACCTGTCTGTGGCCTGTTAGG + Intergenic
948654741 2:239469622-239469644 GCACCAGTCTGTGGCCTGTTAGG - Intergenic
948690258 2:239697713-239697735 GTACCAGTCTGTGGCCTTTTAGG - Intergenic
1169166725 20:3430520-3430542 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1169322013 20:4640760-4640782 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1169417065 20:5426239-5426261 GTACTGGTCTGTAGCCTGTTAGG - Intergenic
1169550366 20:6695939-6695961 ATACCAGTCTATGGTCTGTTAGG - Intergenic
1169555395 20:6744078-6744100 GTACTGGTCTGCGGTCTGTTAGG - Intergenic
1169657459 20:7941304-7941326 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
1169946674 20:10996486-10996508 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1170018833 20:11813291-11813313 ATACCGGTCTGAGGCCTGTTAGG - Intergenic
1170135539 20:13069648-13069670 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1170187064 20:13602823-13602845 GTATCAGTCTGTGGCCTGTTAGG - Intronic
1170561137 20:17559594-17559616 GTATTGGTCTGTGGCCTGTTAGG + Intronic
1170645511 20:18193701-18193723 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1172239087 20:33400211-33400233 GTACCTGTCTGTGGCCTGTGAGG - Intronic
1172280510 20:33704485-33704507 GTACCGGTCCATGGCCTGTTCGG - Exonic
1172410846 20:34721707-34721729 GTAGTGGTCTGTGGCCTGTTAGG - Intronic
1172575532 20:36005449-36005471 GTACAGGTCCGTGGCCTGTTAGG - Intronic
1172622005 20:36323934-36323956 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1172804924 20:37604887-37604909 GTACGGGTCCGTGGCCTGTTAGG + Intergenic
1173204388 20:40981093-40981115 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1173320808 20:41985313-41985335 ATACCAGTCTGTGGCCTGTTAGG + Intergenic
1173477123 20:43367986-43368008 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1173833509 20:46109158-46109180 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1174030816 20:47624594-47624616 GTATCAGTCTGTGGCCTGTTAGG - Intronic
1174044436 20:47723480-47723502 GTAGCGGTCTGTGGCCTGTTAGG + Intronic
1174445117 20:50585791-50585813 GTACTGGTCTGAGGCCTGTTAGG - Intergenic
1174551269 20:51363428-51363450 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1174747746 20:53080746-53080768 GTACAGGTCCGTGGCCTGTTAGG - Intronic
1174866601 20:54142287-54142309 GTACCAGTCTGTGGCCTGTAAGG - Intergenic
1174868889 20:54165135-54165157 GTACTGGTCAGTGGCCTGTTAGG + Intronic
1174986665 20:55461618-55461640 GTACCAGTTTGTGGCCTGTTAGG + Intergenic
1175203611 20:57294251-57294273 GCACCGGTCTGTGGCCTGTTAGG - Intergenic
1175651623 20:60729663-60729685 GTACCGGTCTGAGGCCTGTTAGG + Intergenic
1175729288 20:61342626-61342648 GTCCTGGTCTGTGGCCTGTTGGG - Intronic
1175805867 20:61829107-61829129 GTACCGGTCTGTGGCCTGTTAGG - Intronic
1177043012 21:16135904-16135926 GTACCAGTCCTTGGTCTGTTAGG + Intergenic
1177081315 21:16641715-16641737 GTACTGGTCTGTGTCCTGTTAGG - Intergenic
1177146249 21:17410318-17410340 GTACCGGTCTGCGGCCTATTAGG + Intergenic
1177278040 21:18941673-18941695 GTACTGGTCTGTGGCTTGTTAGG + Intergenic
1177296925 21:19187758-19187780 GTACTAGTCTGTGGCCTGTTAGG + Intergenic
1177417160 21:20808757-20808779 GTACCGGTCTGTGGCCTGTTAGG + Intergenic
1177832216 21:26151813-26151835 GTACCGGTCTGTGGCGTGTTAGG - Intronic
1178148743 21:29769664-29769686 GTACCGGTCCATGGCCTGTTAGG - Intronic
1178296269 21:31412960-31412982 GTACCTGTCTATGGTCTGTTAGG - Intronic
1178319722 21:31596154-31596176 GTACCGTTCTGTGGCCTGTTAGG + Intergenic
1178325299 21:31640949-31640971 GTACCAGTCTGTGGACTGCTAGG - Intergenic
1178458335 21:32776852-32776874 GTACCAGTCAGTGGCCTGTTAGG + Intergenic
1178995382 21:37394501-37394523 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1179036992 21:37766737-37766759 GTGCTGGTCTGTGGCCTGTTAGG + Intronic
1179057085 21:37946178-37946200 GGACCGCTCTGTGGCCTGTTAGG + Intergenic
1179188048 21:39099833-39099855 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1179427025 21:41289673-41289695 GTACCGGTCTGTGGTCTATTAGG - Intergenic
1180100779 21:45584008-45584030 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1180180419 21:46116417-46116439 GCGCAGGTCTGAGGTCTGTCAGG - Intronic
1180938469 22:19641488-19641510 GTACAGGTCTGTGGCCTGTTAGG + Intergenic
1181099277 22:20528573-20528595 GTACAGGTCTGTGGGCTGTTAGG - Intronic
1181567342 22:23747207-23747229 GCACCAGTCTGTGGCCTGTTAGG + Intronic
1181624108 22:24111312-24111334 GTACCAGTCCGTGGCCTGTTAGG + Intronic
1182569343 22:31224882-31224904 GTACGGGTCTGTAGCCTGTTAGG + Intronic
1182722576 22:32415270-32415292 GTCCCGGTCTGTGGCCTGTTAGG - Intronic
1183756587 22:39772338-39772360 GTACCAGTCTGTGACCTGTTAGG - Intronic
1184514191 22:44951465-44951487 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1184591592 22:45487448-45487470 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
949293664 3:2495521-2495543 TTACCTGTCTGTGGCCTGTTAGG + Intronic
949354013 3:3158339-3158361 GCACTGGTCTGTGGCCTGTTAGG - Intronic
949475471 3:4441046-4441068 GTACTGGTCTGTGGCCTATTGGG + Intronic
950250221 3:11458798-11458820 GTACTGGTCCGAGGCCTGTTAGG + Intronic
951050639 3:18089411-18089433 GTACCAGTCCGTGGCCTGTTAGG + Intronic
951207812 3:19942911-19942933 GTACTGGACTGTGGCCTGTTAGG - Intronic
951459920 3:22940396-22940418 GTATCGGTCTGTGACCTGTTAGG + Intergenic
951480688 3:23159336-23159358 GTACTGGTCCGTGGTCTGTTAGG - Intergenic
951509995 3:23489721-23489743 GTACCAGTCCGTGGCCTGTTAGG - Intronic
951628148 3:24689469-24689491 ATACCAGTCTGTGGCCTGTTAGG + Intergenic
952709991 3:36420423-36420445 GTACCGGTCTGTAGCCTGTTAGG + Intronic
952756950 3:36878046-36878068 GTGCTGGTCTGTGGCCTGTTAGG + Intronic
953137701 3:40197340-40197362 GTACTGGTCATTGGTCTGTTAGG - Intronic
953227452 3:41033675-41033697 GTACCAATCTGTGGCCTGTTAGG - Intergenic
953748425 3:45592667-45592689 GTACTGGTCTGTGGCCTGTTAGG - Intronic
954476350 3:50749977-50749999 GTACCAATCTGTGGCCTGTTAGG + Intronic
954766047 3:52917593-52917615 GTACCCGTCTATGGCCTGTTAGG + Intronic
954820878 3:53326482-53326504 GTACTGGTCTGTGGCCTGTTAGG + Intronic
954920636 3:54187896-54187918 GTACTGGTCTGTGGCCTGTTAGG - Intronic
954941649 3:54378439-54378461 GTACTGGTCGGTGGCCTGTTAGG - Intronic
954966448 3:54615780-54615802 ATACTGGTCTCTGGTCTGTTAGG + Intronic
955617579 3:60825501-60825523 GTACCAGTCTGTGGCCTGTTAGG + Intronic
955623900 3:60895957-60895979 GTACCAGTCTGTGGCCTGTTAGG + Intronic
955718972 3:61862028-61862050 GTACCGGTCCCTGGCCTGTTAGG + Intronic
956092529 3:65683140-65683162 GTACTGGTCTGTGGCCTGTTAGG - Intronic
956153135 3:66264425-66264447 GTACTAGTCTGTGGCCTGTTAGG + Intronic
956213832 3:66827924-66827946 GTACCGGTCTGTGGCCTGTTAGG - Intergenic
956390589 3:68769056-68769078 GTACCAGTTTGTGGCCTGTTAGG + Intronic
956522490 3:70121266-70121288 GTACTGATCTGTGGCCTGTTAGG - Intergenic
956601648 3:71029052-71029074 GTACTGGTCTATGGTCTGTTAGG - Intronic
956764394 3:72472241-72472263 GTACTGGTCTATGGCCTGTTAGG + Intergenic
956959071 3:74376268-74376290 GTACTGGTCTGTGGCCTGTTAGG + Intronic
957057505 3:75455288-75455310 GTAGTGGTCTGTGGCCTGTTAGG - Intergenic
957150950 3:76485482-76485504 ATACCAGTTTGCGGTCTGTTAGG - Intronic
957384596 3:79479474-79479496 GTACAGGTCCGTGGCCTGTTAGG - Intronic
957801553 3:85090642-85090664 TTACCGGTCAGTGGCCTGTTAGG + Intronic
957856206 3:85882038-85882060 GTACCAGTTTGCAGTCTGTTAGG - Intronic
958056467 3:88418812-88418834 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
959033664 3:101334136-101334158 GTACCAGTCTGTGGCCTGTTAGG - Intronic
959040845 3:101422001-101422023 GTACCAGTCTGTGGTCTGTTAGG + Intronic
959043258 3:101442540-101442562 GTACTGGTCCGTGGCCTGTTAGG - Intronic
959211970 3:103396682-103396704 GTATTGGTCTGTGGCCTGTTAGG + Intergenic
959294244 3:104514936-104514958 GTACCTGTCTGTGGCCTATTAGG + Intergenic
959386482 3:105714701-105714723 GTACCAGTCTGTGATCTGTTAGG - Intronic
959620761 3:108396548-108396570 GTACAGGTCTGGGGCCTATTAGG - Intronic
959775909 3:110162781-110162803 GTACCCGTTTGTGGCCTGTTAGG + Intergenic
959822181 3:110749150-110749172 GTACTGGTCTGGGGCTTGTTAGG + Intergenic
959846819 3:111042487-111042509 GTACTGGTCTGTGGGCTATTAGG + Intergenic
960264017 3:115599509-115599531 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
960766449 3:121135748-121135770 GTACCAGTCTGTGGCCTGTTAGG - Intronic
960823424 3:121758150-121758172 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
961195034 3:124994316-124994338 CTACCAGTTTGTGGTCTGTTAGG - Intronic
961253025 3:125522502-125522524 GTACCAGTCTGTGGTCTGCTAGG - Intergenic
961295948 3:125884442-125884464 GTAGTGGTCTGTGGCCTGTTAGG + Intergenic
961727288 3:128939938-128939960 GTACCGGTCTCTGGCCTGTTAGG - Intronic
961842008 3:129722152-129722174 GTACAGGTCAGTGGCCTGTTAGG + Intronic
961889850 3:130121731-130121753 GTAGTGGTCTGTGGCCTGTTAGG - Intergenic
962053214 3:131841395-131841417 GTACCAGTCTGTGGCCTGTTAGG + Intronic
962197619 3:133377732-133377754 GTACCAGTCTGTGGCCTGTTAGG + Intronic
962332202 3:134488047-134488069 GTACCAGTCCGTGGCCTGTTAGG + Intronic
962585065 3:136833756-136833778 GTACTAGTCTGTGGCCTGTTAGG - Intronic
962842592 3:139249409-139249431 ATACTGGTCTGTGGCCTGTTAGG + Intronic
963100857 3:141602499-141602521 GTACTGGTCAGTGGCCTGTTAGG - Intronic
963147344 3:142007951-142007973 GTACCAGTCCGTGGCCTGTTAGG - Intronic
963249915 3:143093837-143093859 GTACTGGTCTGAGGCCTGTTAGG + Intergenic
963305547 3:143648523-143648545 GCACTGGTCTGTGGCCTGTTAGG - Intronic
963308064 3:143676225-143676247 GTACAGGTCTGTGGCTTGTTAGG - Intronic
963536790 3:146539413-146539435 GTACCAGTCTGTGGCCTGTTAGG - Intronic
963578952 3:147099906-147099928 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
964264004 3:154873683-154873705 GTACTGATCTGTGGCCTGTTAGG + Intergenic
964744120 3:159996567-159996589 GTACTGGTCTGTGGCCTGTTGGG + Intergenic
964764593 3:160167558-160167580 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
964784035 3:160373920-160373942 GTAGCTGTCTGCTGTCTGTTAGG - Intronic
964876824 3:161376882-161376904 GTACCTATCTGTGGCCTGTTAGG + Intergenic
965639273 3:170815517-170815539 TTACCAGTCTGTGGCCTGTTAGG + Intronic
965769581 3:172167654-172167676 GTACCTGTCTGTGGCATGTTAGG + Intronic
967009867 3:185422800-185422822 GTACCAGTCTGTGGCCTGTTAGG + Intronic
967250922 3:187537094-187537116 GTATGGGTCTGTGGCCTGTTAGG - Intergenic
967455146 3:189676736-189676758 GTACCCATCTGTGGCCTGTTAGG + Intronic
967671393 3:192239520-192239542 GTACTGGTCTGTGGCCTGTTAGG + Intronic
968331484 3:197874170-197874192 GTACCAGTCTGTGGCCTGTTAGG + Intronic
968723244 4:2223272-2223294 GTACCTGTCTGTAGTCTGCTAGG + Intronic
969000330 4:3975701-3975723 GTAGCGGTCTGTGGCCTGTTAGG - Intergenic
969076493 4:4582878-4582900 GTAGCAGTCTGTGGCCTGTTAGG - Intergenic
969182027 4:5449583-5449605 GTACTGGCCTGTGGCCTGTTAGG + Intronic
969641389 4:8401242-8401264 GTACTAGTCTGTGGCCTGTTAGG - Intronic
969753687 4:9132957-9132979 GTAGCGGTCTGTGGCCTGTTAGG + Intergenic
969813580 4:9669145-9669167 GTAGCGGTCTGTGGCCTGTTAGG + Intergenic
969925966 4:10586166-10586188 GTACTGGTCTGTGGTGTGTTAGG - Intronic
970170020 4:13280168-13280190 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
970388897 4:15587318-15587340 GTGCCAGTCTGTGGCCTGTTAGG - Intronic
970620830 4:17816372-17816394 GTACCAGTCTGTGGCCTGTTAGG - Intronic
970633482 4:17980716-17980738 GTACCAGTCTGTGGCCTGTTAGG + Intronic
970690427 4:18613208-18613230 GTACTGGTCCCTGGTCTGTTAGG - Intergenic
970955592 4:21807276-21807298 GTCGCAGTCTGTGGTCTGTTAGG - Intronic
971032931 4:22660543-22660565 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
971212935 4:24637239-24637261 GTACCTGGCTGTGGCCTGTTAGG + Intergenic
971364096 4:25962669-25962691 GTACCAGTCCGTGGCCTGTTGGG - Intergenic
971564557 4:28120757-28120779 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
972250319 4:37292940-37292962 GTACTGGTCCGTGGCCTGTTAGG - Intronic
972368621 4:38399660-38399682 GTACTAGTCTGTGGCCTGTTAGG + Intergenic
972494973 4:39625966-39625988 GTACTGGTCTGTGGCCTGTTAGG + Intronic
972622568 4:40762665-40762687 GTACCTGTCTGTGGCCTGTTAGG + Intronic
972660489 4:41111247-41111269 GTACCATTCTGTGGTCTGTTAGG - Intronic
972663388 4:41140602-41140624 GTACCAGTCTGTGGCCTGTTAGG + Intronic
972675116 4:41252549-41252571 GTACAGGTCTGTGGCCTGTTAGG - Intergenic
973133146 4:46673117-46673139 GTACTGGTCCGAGGCCTGTTAGG - Intergenic
973205446 4:47555113-47555135 GTAACAGTCTGTGGCCTGTTAGG + Intronic
973239536 4:47942603-47942625 GTACTGGTCTGTGGTCTGTTAGG + Intronic
973272127 4:48271904-48271926 GTACCGGTCTGAGGTCTGTTAGG - Intergenic
973977865 4:56281111-56281133 GTACCGGTGTGTGGCCTGTTAGG + Intronic
973990707 4:56404008-56404030 GTACCAGTCTGTGGCTTGTTAGG - Intronic
973996664 4:56466079-56466101 GTACTGGTCTGCAGCCTGTTAGG - Intergenic
974009173 4:56592006-56592028 ATACCGGTCCGTGGCCTGTTAGG + Intronic
974227977 4:59072989-59073011 GTACTGGTCTGTGGCCTGGTAGG - Intergenic
974347831 4:60704354-60704376 GTACCACTCTGTGGCCTGTTAGG + Intergenic
974426683 4:61750928-61750950 GTAGCGGTCTGTGGCCTGTTAGG + Intronic
974502527 4:62726013-62726035 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
974502537 4:62726054-62726076 GTACTGGTCTGTGGCCTATTAGG - Intergenic
975070661 4:70133617-70133639 GTACCGGTCCTTGGCCTGTTAGG + Intronic
975857714 4:78642200-78642222 TTACTGGTCTGTGGCCTGTTAGG - Intergenic
976482865 4:85564849-85564871 GTACCAGTCTGTGGCCAGTTAGG - Intronic
976668156 4:87622487-87622509 ATACCGGTCTGTGGCTTGTTAGG - Intergenic
976703046 4:87991973-87991995 GTACTGGTCTGTGGACTCTTAGG - Intergenic
977180911 4:93872561-93872583 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
977302131 4:95280085-95280107 GTACTGGTCCGTGGTCTGTTAGG - Intronic
977429793 4:96916995-96917017 GTACCATTCTGAGGCCTGTTAGG - Intergenic
977804950 4:101286251-101286273 GTAGCAGTCTGTGGCCTGTTAGG - Intronic
977810555 4:101350438-101350460 GTACCAGTCTGTGGCCTATTAGG - Intergenic
978291963 4:107152381-107152403 CTACTGGTCTGTGGCCTGTTAGG - Intronic
978534622 4:109747995-109748017 GTACTGATCTGTGGCCTGTTAGG - Intronic
978623193 4:110655114-110655136 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
978637298 4:110824626-110824648 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
978952020 4:114572466-114572488 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
979350355 4:119637130-119637152 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
979423782 4:120539128-120539150 GTACTGGTCTGTGGTCTGTGGGG + Intergenic
979464093 4:121016615-121016637 GTACCGGTCCGTGGCCTGTTAGG - Intergenic
979489509 4:121309016-121309038 GTACCTGTCTGTGGCCTGTTAGG + Intergenic
979566289 4:122157627-122157649 GTACTGGTCTGTGGCCTGTTAGG - Intronic
979801040 4:124909158-124909180 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
979835793 4:125365883-125365905 GTACGGGTCTGTGGTCTGTTAGG + Intronic
979837304 4:125387132-125387154 GTACTGGTTTGTGGCCTGTTAGG - Intronic
979852527 4:125591564-125591586 GTACCAGTCTGTGACCTGTTAGG - Intergenic
979977765 4:127218254-127218276 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
980061309 4:128133149-128133171 GTACTGGTCTGTAGCCTGTTAGG - Intronic
980161500 4:129168847-129168869 GTACCTGCTTGAAGTCTGTTAGG - Intergenic
980164813 4:129213170-129213192 GTACTGGTCAGTGGCCTGTTAGG + Intergenic
980508278 4:133752332-133752354 TGACTGGTCTGTGGTCTGTTAGG + Intergenic
981106886 4:140891735-140891757 GTACCAGTCCATGGTCTGTTAGG + Intronic
981728086 4:147868890-147868912 GTACCGGTCCATGGCCTGTTAGG - Intronic
981784489 4:148462136-148462158 GTACCGGTCCATGGCCTGTTAGG + Intergenic
982023895 4:151232950-151232972 GTACCAGTCTATGGCCTGTTAGG + Intronic
982049470 4:151486200-151486222 GTACCAGTCTCTGGCCTGTTAGG - Intronic
982073087 4:151712897-151712919 GTACTGGTCTGTGGCCTGTTAGG + Intronic
982146834 4:152403795-152403817 GGACCAGTCTGTGGCCTGTTAGG - Intronic
982345357 4:154351858-154351880 GTACTGGTCTGTGGCCTGTTGGG - Intronic
983295059 4:165856786-165856808 GTACCTGTCTGTGACCTGTTAGG - Intergenic
983354126 4:166633326-166633348 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
984079797 4:175233264-175233286 GTAGCGGTCCGTGGCCTGTTAGG + Intergenic
984385296 4:179048038-179048060 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
984682431 4:182625253-182625275 GTACAGATCTGCGGCCTGTTAGG + Intronic
984736115 4:183109699-183109721 GTACCGGTCAATGGCCTGTTAGG - Intronic
984772944 4:183454123-183454145 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
984941769 4:184939029-184939051 GTACTGGTCGGTGGCCTGTTAGG - Intergenic
985684500 5:1274715-1274737 GCACCGGTCTGGGGCCTGTTAGG - Intronic
986216454 5:5724054-5724076 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
986490227 5:8281525-8281547 GTGCTGGTCTGATGTCTATTGGG + Intergenic
986513789 5:8539818-8539840 TTGCAGGTTTGAGGTCTGTTGGG - Intergenic
987018830 5:13848878-13848900 GCACCAGTCTGTGGCCTGTTAGG - Intronic
987141456 5:14951144-14951166 GTACTGGTCCGAGGCCTGTTAGG + Intergenic
987184940 5:15407699-15407721 GTACCGGTCTGTGGCCTGTTAGG - Intergenic
987230627 5:15890134-15890156 CTACCGGTCTGTGGCCAGTTAGG + Intronic
987447415 5:18037503-18037525 GTATTGGTCTGTGGCCTGTTAGG + Intergenic
987528558 5:19084447-19084469 ATACTGGTCTGTGGCCTGTTAGG + Intergenic
988123004 5:26992234-26992256 GTACTGGTCCCTGGTCTGTTAGG - Intronic
988392941 5:30659096-30659118 GTACCAGTCTATGGCCTGTTAGG - Intergenic
988440677 5:31228825-31228847 GTACCAGTCTGCAGCCTGTTAGG - Intronic
988545872 5:32156845-32156867 GTACTGGTCTGTGGCCTGTTAGG - Intronic
988641771 5:33048566-33048588 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
988813623 5:34808997-34809019 GTACCAGTCTGTGGCCTGTTAGG - Intronic
988912433 5:35857128-35857150 GTGCCTGACTCAGGTCTGTTAGG - Intronic
989163606 5:38414042-38414064 ATACCAGTCTGTGGCCTGTTAGG - Intronic
989225594 5:39024234-39024256 GTACAGGTCTGTGGTTTGCTAGG - Intronic
989227544 5:39047463-39047485 GTACCAGTCCGTGGCCTGTTAGG - Intronic
989469183 5:41795301-41795323 GTACCGGTCCATGGCCTGTTAGG - Intronic
989747501 5:44847444-44847466 GTACCTGTCAGTGGCCTGTTAGG - Intergenic
990972176 5:61520067-61520089 GTACCAGTCTGTGGTCTGTTAGG - Intronic
991036849 5:62135928-62135950 ATACCGGTCTATGGCCTGTTAGG - Intergenic
991192330 5:63889026-63889048 GTACTGATCTGTGGCCTGTTAGG + Intergenic
991575555 5:68099637-68099659 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
991625534 5:68596934-68596956 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
992613519 5:78528265-78528287 GTACCGGTCTGTGGCCTGTTAGG + Intronic
992897545 5:81258589-81258611 GTACAGGTCTGTGGCCTGTTAGG + Intronic
993011869 5:82492295-82492317 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
993140341 5:84025240-84025262 GTACTGGTCAGTGGCCTGTTAGG + Intronic
993391342 5:87322194-87322216 GTACCTGTCTATGGCCTGTTAGG + Intronic
993426048 5:87765248-87765270 GCACCAGTCTGCGGCCTGTTAGG - Intergenic
993558142 5:89367392-89367414 GTACCAGTTTGTGGCCTGTTAGG - Intergenic
994198029 5:96941332-96941354 GTACCAGTCTCTGGCCTGTTAGG - Intronic
994303159 5:98171239-98171261 GTAACAGTCTGTGGCCTGTTAGG - Intergenic
994329483 5:98488854-98488876 GTACTGGTCTGAGGCCTGGTAGG - Intergenic
994424585 5:99568828-99568850 ATACAGGTCTGTGGCCTGTTAGG + Intergenic
994516761 5:100782172-100782194 GTACCAGTCAGTGGCCTGTTAGG + Intergenic
994669003 5:102744028-102744050 GTACTGGTTTGTGGCCTGTTAGG + Intergenic
994819832 5:104634945-104634967 GTACCTGTCTGGGGCCTGTTGGG - Intergenic
994985174 5:106924018-106924040 CTACTGGTCTGTGGCCTGTTAGG + Intergenic
995305309 5:110639946-110639968 GTACCAGTCTGTGGTCTGTTAGG - Intronic
995548725 5:113258378-113258400 GTACTGGTCTATGGCCTGTTAGG + Intronic
995627815 5:114098364-114098386 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
996228367 5:121030406-121030428 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
996383532 5:122886003-122886025 GAAACGGTCTGTGGCCTGTTAGG - Intronic
996432242 5:123394539-123394561 GTACAGGTTTGTGGCCTGTTAGG - Intronic
996713725 5:126569023-126569045 GTACCAGTCTGTGGCCTATTAGG + Intronic
997693849 5:135845991-135846013 GTACCAGCCTGTGGCCTGTTAGG + Intronic
997715277 5:136037984-136038006 GTATGGGTCTGGGGTCTGCTTGG - Intronic
997740898 5:136252849-136252871 GTACCAGTCTGTGGCCTGTTAGG - Intronic
997825636 5:137104531-137104553 CTACTGGTCTGTGGTCTGTTAGG + Intronic
998872920 5:146570539-146570561 GTACTGGTCTGTGGCCTATTAGG - Intergenic
998926708 5:147134704-147134726 GTACCAGTCTGTGGTCTGTTAGG - Intergenic
999502872 5:152164390-152164412 GTACCAGGTTGTGGTCTGTTAGG + Intergenic
999512662 5:152268939-152268961 GTACCAGTCTATGGCCTGTTAGG - Intergenic
999512822 5:152270593-152270615 GTACAGGTCTGTGGCCTATTGGG + Intergenic
999559298 5:152782847-152782869 GTACCAGTCTGTGCCCTGTTAGG - Intergenic
1000105261 5:158053224-158053246 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
1001350924 5:170963760-170963782 GTACTAGTCTGTGGCCTGTTAGG - Intronic
1001538104 5:172513896-172513918 GTACTGGTCCAAGGACTGTTAGG + Intergenic
1002911474 6:1494331-1494353 CTACCAGTCTGTGGCCTGTTGGG - Intergenic
1003141762 6:3477724-3477746 GTTCCAGTCTGTGGTCTGTTAGG - Intergenic
1003231944 6:4262174-4262196 GTACCGATCTCTGGCCTGTTGGG + Intergenic
1003344859 6:5257543-5257565 GTACTGGTCCGTGGCCTGTTAGG + Intronic
1003696681 6:8412906-8412928 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
1003882338 6:10490083-10490105 GTACCAGTCTGTGGCTTGTTAGG + Intergenic
1004121209 6:12823986-12824008 GTACTGGTCTGTGATGTGTTAGG + Intronic
1004148522 6:13092240-13092262 GGACTGGTCTGTGGCCTGTTAGG - Intronic
1004164988 6:13249145-13249167 GTATCAGTCTGTGGCCTGTTAGG + Intronic
1004444400 6:15684956-15684978 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1004597553 6:17114775-17114797 GTACTGGTCCGTGGCCTGTTAGG - Intronic
1004672520 6:17810941-17810963 GTACGGGTCCGTGGCCTGTTAGG - Intronic
1004770032 6:18770939-18770961 GTACTTGTCTGTGGTCTGTTAGG + Intergenic
1004795628 6:19080164-19080186 GTACCGGTCTGTGGCCTGTTAGG + Intergenic
1004834385 6:19514950-19514972 GTACCAGTCTGTGGTCTGACAGG + Intergenic
1004852270 6:19712382-19712404 GTACCAGTCTGTGACCTGTTAGG + Intergenic
1004893815 6:20127413-20127435 GTATTGGTCTGTGGCCTGTTAGG + Intronic
1004949735 6:20655456-20655478 GTACTCGTCTGTGGCCTGTTAGG + Intronic
1004952216 6:20686250-20686272 GTACTGGTCTGTGGCTTGTTAGG + Intronic
1005086783 6:22015158-22015180 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1005387974 6:25304654-25304676 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1005660525 6:27994256-27994278 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1005823631 6:29618588-29618610 GTACTGGTCCTAGGTCTGATGGG + Intronic
1005921433 6:30405429-30405451 GTACAGGTTTGTGGCCTGTTGGG + Intergenic
1005932763 6:30496194-30496216 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1006595397 6:35189497-35189519 GTACCTGTCTGTGGTCTGTTAGG + Intergenic
1006595472 6:35190083-35190105 GTACCTGTCTGTGGTCTGTTAGG - Intergenic
1006686152 6:35836063-35836085 GTACCAGTCTGCGGTCTGTCAGG + Intronic
1006703564 6:35997137-35997159 GTACTGGTTTGTGGCCTGTTAGG + Intronic
1006720170 6:36145079-36145101 ATACCTGTCTGTGGCCTGTTAGG - Intergenic
1007152648 6:39709518-39709540 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1008130234 6:47712936-47712958 GTACCGGGCTGTGGCCTCTTAGG + Intronic
1008523812 6:52387724-52387746 GTACCTGTCTGTGGCCTGTTAGG + Intronic
1008691244 6:53981630-53981652 GTACTGGTCTGTGGCCTATTAGG + Intronic
1008955663 6:57213269-57213291 GTACCGTTCTGTGGCCTGTTAGG - Intronic
1009303171 6:62052861-62052883 GTACTGGTCTGTGACCTGTTAGG - Intronic
1009439632 6:63661929-63661951 GTACCAGTTTGGGGCCTGTTAGG + Intronic
1009513417 6:64582204-64582226 GTACCTGTCTGTGGCCTGTTAGG + Intronic
1009922748 6:70083025-70083047 GTACCGGTCTGTGGACTGTTAGG - Intronic
1009958316 6:70484779-70484801 GTACTTGTCTGTGGCCTGTTAGG - Intronic
1009962086 6:70535380-70535402 GTACCTGTCTGTGGCCTCTTAGG + Intronic
1010120915 6:72375108-72375130 GTACCAGTCTGTGGCCTGTTGGG - Intronic
1010123329 6:72405154-72405176 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1010621394 6:78080752-78080774 GTTCCAGTCTGAAGACTGTTTGG + Intergenic
1010632150 6:78210462-78210484 GTATCTGTCTGTGGCCTGTTAGG + Intergenic
1010776631 6:79894052-79894074 GTACCGGTTTGTGGCCTGTTAGG + Intergenic
1010877114 6:81120525-81120547 GTACTGGTCTGCGGCCTATTAGG + Intergenic
1011292740 6:85793332-85793354 ATACCAGTCTGTGGACTGTTAGG + Intergenic
1011637647 6:89389081-89389103 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1012211994 6:96530924-96530946 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1012281757 6:97336059-97336081 GTAGCAGTCTGTGGCCTGTTAGG - Intergenic
1012973390 6:105754911-105754933 GTACCATTCTGTGGCCTGTTAGG + Intergenic
1013104357 6:107014079-107014101 GTACTGCTCTGTGGCCTGTTAGG - Intergenic
1013900647 6:115152224-115152246 GTAACGGTCTTTGGACTGTTTGG + Intergenic
1014102824 6:117530517-117530539 GTACTGGTCAGTGGCCTGTTAGG - Intronic
1014151523 6:118061950-118061972 GTACCAGTCCGTGGCCTGTTAGG - Intronic
1014203592 6:118630747-118630769 GCACCGGTCAGTGGCCTGTTGGG + Intronic
1014304971 6:119728386-119728408 GTACCAGTCTGTGTCCTGTTAGG - Intergenic
1014480065 6:121925236-121925258 CTACAGGTCTGTGGTTTGTTAGG - Intergenic
1014600080 6:123400615-123400637 GTACTGGTCTGTGGCCTGATAGG - Intronic
1014747551 6:125217635-125217657 GTACCGGTCTGTTACCTGTTAGG - Intronic
1014895901 6:126898661-126898683 ATACCAGTCTGTGGCCTGTTAGG - Intergenic
1015001285 6:128219547-128219569 GTACTGGTCTGTGGCCTGTCAGG - Intronic
1015066806 6:129039892-129039914 GTACCAGCCTGTGGCCTGTTAGG - Intronic
1015360104 6:132330178-132330200 GTACTGGTCCGTGGCCTGTTAGG + Intronic
1015508536 6:134014339-134014361 GTACAGGTCTGTGGCCTGTTAGG - Intronic
1015942759 6:138468393-138468415 GTACCCATCTGTGGCCTGTTAGG + Intronic
1015985664 6:138881878-138881900 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1016025882 6:139286579-139286601 GTACCAGTCCGTGGCCTGTTAGG + Intronic
1016441105 6:144084515-144084537 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1016634264 6:146269551-146269573 GTACCAATCTGTGGGCTGTTAGG + Intronic
1016666907 6:146652925-146652947 GTACCAATCTGTGGCCTGTTAGG + Intronic
1016672477 6:146725322-146725344 GTCCTGGTCCGAGGCCTGTTAGG + Intronic
1016702298 6:147067470-147067492 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1016757013 6:147698188-147698210 GTACCGGTCTGTGGCCTGTTAGG - Intronic
1016921818 6:149302832-149302854 GTACTGGTCTGGAGGCTGTTAGG + Intronic
1017207503 6:151819356-151819378 GTACTGGTTTGGGGCCTGTTAGG + Intronic
1017318268 6:153057966-153057988 GTATTGGTCTGTGGCCTGTTAGG - Intronic
1017969434 6:159298966-159298988 GTATCAGTCTGTGGCCTGTTAGG + Intergenic
1018045831 6:159965601-159965623 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1018097022 6:160397369-160397391 GTACCAGTTTGTGGCCTGTTAGG - Intronic
1018104026 6:160466240-160466262 ATCCTGGTCTGTGGTCTGTTAGG - Intergenic
1018376415 6:163217561-163217583 GCACTGGTCTGTGCTCTGTTAGG + Intronic
1018489300 6:164275411-164275433 CTACCAGTCTGTGGCCTGTTAGG + Intergenic
1018662314 6:166099521-166099543 ATACTGGTCTGTGGCCTGTTAGG - Intergenic
1018834435 6:167472453-167472475 GTACTGGTCTGCAGCCTGTTAGG - Intergenic
1020598780 7:10247224-10247246 GTAGTGGTCTGGGGCCTGTTAGG + Intergenic
1020826488 7:13035539-13035561 GTACCTGTCTGTGGCCCGTTAGG + Intergenic
1021177284 7:17463605-17463627 GTACCTGTCCGTGGCCTGTTAGG + Intergenic
1021204954 7:17769100-17769122 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1021372856 7:19871545-19871567 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1021478165 7:21086199-21086221 GTACCAGTCCATGGTCTGTTAGG + Intergenic
1021554360 7:21904442-21904464 GAACCAGTCTGTGGCCTGTTTGG + Intronic
1021808152 7:24377020-24377042 GTCCAGGACTGAGGTCTGGTAGG - Intergenic
1021877587 7:25063086-25063108 GTATTGGTCTGTGGCCTGTTAGG + Intergenic
1022494938 7:30846974-30846996 GCACTGGTCTGTGGCCTGTTAGG - Intronic
1022708588 7:32830629-32830651 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1022914588 7:34934848-34934870 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1023002284 7:35822641-35822663 GTAGCGGTCTGTGGCCTGTTAGG - Intronic
1023383923 7:39635852-39635874 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1023423618 7:40010746-40010768 GTACTGGCCTGTGGCCTGTTAGG - Intronic
1023491073 7:40742616-40742638 GTACCGGTCCTTGGCCTGTTAGG - Intronic
1023549097 7:41349911-41349933 GTACCGGTCCGTGGCCTGTTAGG + Intergenic
1023591004 7:41780506-41780528 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1023921149 7:44631044-44631066 GTACTGGTCAGTGGCCTGTTTGG - Intronic
1024015214 7:45307486-45307508 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
1024127261 7:46312202-46312224 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1024237837 7:47411525-47411547 TTATCGGTCTGTGGCCTGTTAGG - Intronic
1024659924 7:51483641-51483663 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1024690425 7:51795493-51795515 GTACCTGTCTGTGGCCTGTTAGG - Intergenic
1024780838 7:52846488-52846510 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1025014077 7:55424707-55424729 GTACTGGTCCGTGGCCTGTTAGG + Intronic
1025019154 7:55467181-55467203 GTACTGCTCTGTGGCCTGTTAGG - Intronic
1025104731 7:56161801-56161823 GTACCAGTCTGTGACCTGTTAGG + Intergenic
1026225311 7:68435151-68435173 GTATCCGTCTGTGGTCTGTTAGG - Intergenic
1026300544 7:69094058-69094080 GTACCAGTCTGTGGCCTGTCAGG - Intergenic
1026313780 7:69210863-69210885 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1026316033 7:69228460-69228482 GTACCAGTCTGTGACCTGTTAGG - Intergenic
1026564125 7:71475625-71475647 GTACTGGTCTGCAGCCTGTTAGG - Intronic
1026620445 7:71945477-71945499 GCACCAGTCTGTGGCCTGTTAGG + Intronic
1027195883 7:76029946-76029968 GTACCAGTCTGTGGTCTGTTAGG - Intronic
1027787801 7:82602173-82602195 ATACCGGTATGTGGCCTGTTAGG + Intergenic
1028761610 7:94503333-94503355 GTACCAGTCTGTGAGCTGTTAGG - Intergenic
1029019580 7:97350405-97350427 GTACTGGTCAGTGTTCTGTTAGG + Intergenic
1029431794 7:100536002-100536024 GTACCTGTCTGTGGCCTGTTAGG - Intergenic
1030139877 7:106293493-106293515 GCACCTGTCAGTGGTCTGTTAGG + Intergenic
1030545481 7:110889596-110889618 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1030661269 7:112221814-112221836 GTACTGGTTTGTGGCCTGTTAGG - Intronic
1030694428 7:112569288-112569310 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
1030743842 7:113141111-113141133 GTACTGGTCTATGGCCTGTTAGG + Intergenic
1030771702 7:113483767-113483789 GTACAGGTCTGTGGCCTGTTGGG + Intergenic
1031045201 7:116879708-116879730 GTACCAGTCTGGGGCCTGTTAGG - Intronic
1031094638 7:117403780-117403802 GCACTGGTCTGTGGCCTGTTAGG + Intronic
1031169659 7:118276806-118276828 TTACTGGTCTGTGGCCTGTTAGG + Intergenic
1031634259 7:124082898-124082920 GTAGCGGTCAGTGGCCTGTTAGG + Intergenic
1031826746 7:126575102-126575124 GTACCGGTTTGTGGCCTGTTAGG + Intronic
1032231234 7:130076269-130076291 GTACCGGTCCATGGCCTGTTAGG - Intronic
1032343192 7:131094823-131094845 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1032645252 7:133816890-133816912 GTACGGGTCTGTGGCCTGTTAGG - Intronic
1033292519 7:140099539-140099561 GTACCAGTCCGTGGCCTGTTAGG + Intronic
1033479825 7:141728702-141728724 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1034046179 7:147930051-147930073 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1034135261 7:148762055-148762077 GTATGGGTCTGTGGCCTGTTAGG - Intronic
1034144163 7:148853562-148853584 GTACCCGTCTGTGGCCCGTTAGG - Intronic
1034635104 7:152560977-152560999 GCACTGGTCTGTGGCCTGTTAGG + Intergenic
1034685346 7:152966309-152966331 GTACCACTCTGTGGCCTGTTTGG - Intergenic
1035015062 7:155758585-155758607 CTACCAGTCTGTGGCCTGTTAGG - Intronic
1035394400 7:158525877-158525899 GGACAGGTCTGAGGTCTGTGAGG - Intronic
1036005090 8:4653016-4653038 GTACCTATCTGTGGCCTGTTAGG - Intronic
1036132752 8:6131700-6131722 GTACCTGTTTGTGGCCTGTTAGG - Intergenic
1036159699 8:6375690-6375712 GTACCAGTTTGTGGCCTGTTAGG + Intergenic
1036172018 8:6496423-6496445 GTACCAGTCTGTGGCCTATTAGG - Intronic
1036226681 8:6964996-6965018 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1036376899 8:8208291-8208313 GTAGCGGTCTGTGGCCTGTTAGG + Intergenic
1036431688 8:8697996-8698018 GTACCAGTCTGTGGCCTGTCAGG + Intergenic
1036692543 8:10952814-10952836 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1036874008 8:12457371-12457393 GTAGCGGTCTGTGGCCTGTTAGG - Intergenic
1036966281 8:13301685-13301707 GTACCGGTCTGTGATCTGTTAGG + Intronic
1037496293 8:19444111-19444133 TTACTGGTCTGTGGCCTGTTAGG - Intronic
1037530333 8:19766611-19766633 GTACCAGTCTCTGGCCTGTTAGG + Intergenic
1037603614 8:20419541-20419563 GTACCAGTCAGTGGCCTGTTAGG - Intergenic
1037690371 8:21176814-21176836 GTGCAGGTCTGTGGCCTGTTAGG - Intergenic
1037690381 8:21176862-21176884 GTGCAGGTCTGTGGCCTGTTAGG - Intergenic
1037690393 8:21176910-21176932 GTGCCAGTCTGTGGCCTGTTAGG - Intergenic
1037734942 8:21558316-21558338 GTACTGGTCCATGGTCTGTTAGG - Intergenic
1037923350 8:22824906-22824928 GTACCGGTCCATGGCCTGTTAGG - Intronic
1037954000 8:23039257-23039279 GTACTGGTCCGTGGCCTGTTAGG - Intronic
1038191089 8:25321734-25321756 ATACCAGTCTGTGGCCTGTTAGG - Intronic
1038368326 8:26960903-26960925 GTACCATTCTGTGGCCTGTTAGG + Intergenic
1038676009 8:29623558-29623580 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
1038706585 8:29899567-29899589 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1039114242 8:34074496-34074518 GTACCCATCTGTGGCCTGTTAGG - Intergenic
1039187359 8:34932061-34932083 GTACTGGTCTGTGGCTTGTTAGG - Intergenic
1039961096 8:42248309-42248331 GTCCCGGTCTGTGGCCTGTTAGG - Intergenic
1040031095 8:42824431-42824453 ATACCAGTCTGTGGCCTGTTAGG - Intergenic
1040858976 8:51979396-51979418 GTACCGCTCTGTGGCCTGTTAGG - Intergenic
1041225890 8:55697782-55697804 GTATTGGTCTGTGGCCTGTTAGG - Intronic
1041250512 8:55929902-55929924 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1041281602 8:56215667-56215689 GTACTGGTCTTCGGTCTGTTAGG - Intronic
1041439720 8:57881804-57881826 GTACCTGTCTGCGACCTGTTAGG + Intergenic
1041498546 8:58514334-58514356 GTACCCGTCTGTGGCCTTTTAGG + Intergenic
1041637066 8:60156318-60156340 GAAACGGTCTGGGGGCTGTTGGG + Intergenic
1041793788 8:61724996-61725018 GTACTGGTCTGTGATCTGTTAGG - Intergenic
1041928265 8:63260275-63260297 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1042315704 8:67423876-67423898 GTACTGGTCCGAGGCCTGTTAGG + Intronic
1042425461 8:68643035-68643057 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1042707897 8:71680968-71680990 GTACTGGTCTGAGGCCTGTTAGG + Intergenic
1042827593 8:72994184-72994206 GTACTGGTCTGTGGCCTATTAGG - Intergenic
1043187319 8:77170419-77170441 GTACCAGTCTGTGTCCTGTTAGG - Intergenic
1043417921 8:80070642-80070664 GTACCCATCTGTGGCCTGTTAGG - Intronic
1043772810 8:84226031-84226053 GTACTGGTCTGTGGCCTATTAGG + Intronic
1043781304 8:84339247-84339269 GTACCAGTTTGTGGCCTGTTGGG + Intronic
1044064983 8:87688183-87688205 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1044136712 8:88594764-88594786 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1044158782 8:88886333-88886355 GTACCAGTCCATGGTCTGTTAGG + Intergenic
1044261876 8:90134521-90134543 GTATCAGTCTGTGGCCTGTTGGG - Intergenic
1044519010 8:93176313-93176335 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1044519926 8:93187566-93187588 GTACTGGTCTTTGGTCTGTTAGG - Intergenic
1044677950 8:94748550-94748572 GTACCCATCAGAGGCCTGTTAGG + Intronic
1044784915 8:95783451-95783473 GTACTGGTCGGTGGCCTGTTAGG + Intergenic
1044900561 8:96939364-96939386 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1045249174 8:100468819-100468841 GTACAGGTCTGTGGCCTATTAGG - Intergenic
1045885950 8:107097981-107098003 GTACCATTCTGTGGCCTGTTAGG - Intergenic
1046524522 8:115367550-115367572 GTACCAGTCTGTGGCGTGTTAGG + Intergenic
1046534951 8:115497420-115497442 GTACCAGTCTGTGGCCTGTTAGG - Intronic
1046600574 8:116312669-116312691 GTACCAGTCCATGGTCTGTTAGG + Intergenic
1046622498 8:116543160-116543182 GTACCGGTCCGTGGCCTGTTAGG - Intergenic
1046858585 8:119065171-119065193 GTATCGGTTTGTGGCCTGTTAGG + Intronic
1046928318 8:119817234-119817256 ATACAGGTCTGTGGCCTGTTAGG + Intronic
1046998809 8:120553100-120553122 GTAGCGGTCTGTGGCCTGTTAGG - Intronic
1047177268 8:122553692-122553714 GTACCAGTCCGTGGCCTGTTAGG - Intergenic
1047188552 8:122657415-122657437 GTACCAGTCTATGGCCTGTTAGG - Intergenic
1047891384 8:129315170-129315192 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1047983120 8:130204056-130204078 GTACAGGTCTGTGGCTTGTTAGG + Intronic
1048044824 8:130763737-130763759 ATACCTGTCTGTGGCCTGTTAGG - Intergenic
1048462615 8:134635115-134635137 GTACGGGTCTGTGGCCTGTTAGG - Intronic
1048481062 8:134793697-134793719 GTACTGGTCTGTGGCCTGTTAGG - Intergenic
1048802152 8:138204098-138204120 GTACTGGCCTGTGGCCTGTTAGG - Intronic
1049025359 8:139984577-139984599 GACCAGGTCTGAGGTCTGTAAGG + Intronic
1049626057 8:143621993-143622015 GTTCCGGTCTGTGGCCTGTTAGG - Intergenic
1050088642 9:1993107-1993129 GTACTGGTCGGTGGCCTGTTAGG - Intergenic
1050161736 9:2726723-2726745 GTACTTGTCTGTGGCCTGTTAGG + Intronic
1051000946 9:12280964-12280986 GTACCAGTCTGTGGGCTGTTAGG - Intergenic
1051063840 9:13077480-13077502 GTACCAGTCCGTGGTCTGTTAGG - Intergenic
1051261752 9:15271657-15271679 GTACTGGTCTGTAGCCTGTTAGG - Intronic
1051286412 9:15501928-15501950 GTACCCGTCCGTGGCCTGTTAGG + Intronic
1051554334 9:18365754-18365776 GTACCTATCTGTGGCCTGTTAGG + Intergenic
1051831904 9:21288707-21288729 GTACCGGTCCATGGCCTGTTAGG + Intergenic
1052189519 9:25642317-25642339 GTACAGATCTGTGGCCTGTTAGG - Intergenic
1052202392 9:25798900-25798922 GTACGGGTCAGTGGCCTGTTAGG + Intergenic
1052293127 9:26866930-26866952 GTACCAATCTGTGGCCTGTTAGG + Intronic
1053108191 9:35432192-35432214 GTACAGGTATGAGGTGTCTTTGG + Intergenic
1053153167 9:35755761-35755783 GTACCAGTCTGTGGCCTGTTAGG - Exonic
1054737533 9:68770530-68770552 GTACCAGTCTGCGGCCTGTAAGG + Intronic
1054809767 9:69425536-69425558 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1055053398 9:72001506-72001528 GTAGTGGTCTGTGGCCTGTTAGG - Intergenic
1055539746 9:77291060-77291082 GTACCGGTCTGTGACCTGTTAGG + Intronic
1055909323 9:81329311-81329333 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1056144087 9:83712014-83712036 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1056189174 9:84167825-84167847 GTGCCAGTCTGTGGCCTGTTAGG + Intergenic
1056984670 9:91351595-91351617 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1057007166 9:91570383-91570405 GTCCCAGTCTGTGGCCTGTTAGG - Intronic
1057420988 9:94912247-94912269 GTACCGCTCTTAGCTTTGTTAGG + Intronic
1057460176 9:95254029-95254051 GTACCAGTCCGTGGCCTGTTAGG - Intronic
1058190963 9:101915116-101915138 GTACTAGTCTGTGGCCTGTTAGG - Intergenic
1058779272 9:108317098-108317120 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1058824944 9:108766889-108766911 GTACCAGTCAGTGGCCTGTTAGG + Intergenic
1059017291 9:110533171-110533193 GTACTGATCTGTGGCCTGTTAGG - Intronic
1059151735 9:111955293-111955315 GTACCCGTCTGTGGCCTGTTAGG - Intergenic
1059164345 9:112064202-112064224 GTACCAGTCTGTGGCCTGTTAGG + Intronic
1059347998 9:113645340-113645362 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1059377796 9:113899391-113899413 GTACAGGTCCGTGGCCTGTTGGG + Intronic
1059795733 9:117694448-117694470 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1059898120 9:118891325-118891347 GTTCTGGTCTGTGGCCTGTTAGG + Intergenic
1060333920 9:122703915-122703937 GTACCAATCTGTGGTCTGTTAGG + Intergenic
1060346013 9:122816420-122816442 GTATCGTTCTGTGGCCTGTTAGG - Intronic
1060643265 9:125257075-125257097 GTACCCGTCTGTGGCTTGTTAGG + Intergenic
1061354737 9:130095985-130096007 GTTCCAGTCCCAGGTCTGTTGGG - Intronic
1061527829 9:131182293-131182315 GTACCGGTCTGTGGCCTCTTAGG + Intronic
1062701879 9:137910804-137910826 GTACTGTTCTGTGGCCTGTTAGG - Intronic
1185742374 X:2544136-2544158 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1185837444 X:3358255-3358277 GTACCAGTCGGTGGCCTGTTGGG + Intergenic
1185930912 X:4202551-4202573 GTACTGGTCTGTGTCCTGTTAGG - Intergenic
1185981512 X:4785117-4785139 ATACCGGTCTGTGGCCTGTTAGG + Intergenic
1186008319 X:5100129-5100151 GTACCAGTCTGTGACCTGTTAGG + Intergenic
1186022254 X:5269266-5269288 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
1186336540 X:8595791-8595813 GTAGCAGTCTGTGGCCTGTTAGG + Intronic
1186394142 X:9191113-9191135 GTACTGGTCCGTGGCCTGTTAGG + Intergenic
1186654124 X:11594483-11594505 GTACTGGTATGTGGCCTGTTAGG + Intronic
1187328778 X:18316672-18316694 GTACTGGCCTGTGGCCTGTTAGG + Intronic
1187460672 X:19484141-19484163 GTACCGGTCAGTGGCCTGTTAGG + Intronic
1187570547 X:20496361-20496383 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1188065936 X:25659293-25659315 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1188174996 X:26978028-26978050 GTACTAGTCTGTGGCCTGTTAGG - Intergenic
1188232866 X:27687045-27687067 GTACCTGTCTGTGGCCTGTTAGG - Intronic
1188292828 X:28410084-28410106 GTACGAGTCTGTGGCCTGTTAGG + Intergenic
1188700235 X:33250471-33250493 GTACTGGTCTGTGGCCTGTTAGG - Intronic
1188972664 X:36636659-36636681 GTACTGGTCTGTGGCCAGTTAGG + Intergenic
1189382594 X:40512507-40512529 GTGCTGGTCTGTGGCCTGTTAGG + Intergenic
1189483880 X:41414257-41414279 GTACCAGTCTGTGGCCTGTTAGG + Intergenic
1189749851 X:44209680-44209702 GTACCAGTCCGTGGCCTGTTAGG + Intronic
1189880213 X:45483184-45483206 GTACCAGTTTGTGGCCTGTTAGG - Intergenic
1190027190 X:46935437-46935459 TTACCAGTCTGTGGCCTGTTAGG + Intronic
1190299631 X:49049454-49049476 GTACCAGTCAGTGGCCTGTTAGG - Intergenic
1190402183 X:50048323-50048345 ATACCAGTCTGTGGCCTGTTAGG - Intronic
1190421357 X:50287791-50287813 GTACTAGTCTGTGGCCTGTTAGG + Intronic
1190616645 X:52240536-52240558 GTACTGGTCCGTGGTCTGTTAGG - Intergenic
1192102264 X:68277373-68277395 GCACCAGTCTGTGGCCTGTTAGG - Intronic
1192356703 X:70410805-70410827 GTACTGGTCAGTGGCCTGTTAGG - Intronic
1192496691 X:71620953-71620975 ATACCGGTCTGTGGCCTGTTAGG - Intergenic
1192548660 X:72035853-72035875 ATACCAGTCTGTGGCCTGTTTGG + Intergenic
1193037297 X:76965949-76965971 GTACCGGTTCGTGGCCTGTTAGG - Intergenic
1193869110 X:86775296-86775318 GTACAGGTCTGTGGCCTGTTAGG + Intronic
1194087341 X:89545116-89545138 GTACTGCTCTGTGGCCTGTTAGG + Intergenic
1194601087 X:95922843-95922865 GTACTGGTCCGTGGCCTGTTAGG - Intergenic
1194786260 X:98087563-98087585 GTACCGGTCCATGGCCTGTTAGG - Intergenic
1194945593 X:100063273-100063295 GTACCAGTCTGTGGTCTGTTAGG + Intergenic
1195423331 X:104699582-104699604 GTACCAGTCAGTGGCCTGTTAGG - Intronic
1195493249 X:105498844-105498866 GTACCAGTCTGTGGCCTTTTGGG + Intronic
1195761245 X:108248737-108248759 GTATCAGTCTGTGGCCTGTTAGG + Intronic
1195768832 X:108327076-108327098 GTACCTGTCTGTGGCCTGTTAGG + Intronic
1195922380 X:109996402-109996424 ATACCAGTCTGTGGCCTGTTAGG - Intergenic
1196193490 X:112817603-112817625 GTACAGGTTTGAGGACTCTTGGG - Intronic
1196267311 X:113665569-113665591 GTACAGGTCTGTGGCCTGGTAGG + Intergenic
1196364753 X:114911867-114911889 ATACTGGTCTGCGGCCTGTTAGG - Intergenic
1197473782 X:126895005-126895027 GTACTGGTCTGCGACCTGTTAGG - Intergenic
1197840845 X:130744798-130744820 GTACCGGTCCGTGGCCTGTTAGG + Intronic
1197932425 X:131709793-131709815 GTACTGTTCTGTGGTCTCTTAGG - Intergenic
1197976012 X:132166679-132166701 GTACAGGTCTGTGGCCTGTTGGG + Intergenic
1197982141 X:132228280-132228302 GTACCGGTCTGTGGCCTGTTAGG + Intergenic
1198066779 X:133106026-133106048 GTACTGGTCTGTGGCCTATTAGG + Intergenic
1198188771 X:134282832-134282854 GTACTGGTCTGTGGCCTGTTAGG + Intergenic
1198271077 X:135056419-135056441 GTACCAGTCTGTGGCCTGTTGGG - Intergenic
1198375434 X:136034136-136034158 GTACTGGTCCGTGGCCTGTTGGG + Intronic
1198617681 X:138477548-138477570 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1199283954 X:146035745-146035767 GTACCAGTCCGTGGCCTGTTAGG + Intergenic
1199981614 X:152923822-152923844 GTACCAGTCTGTGGTCTGCTGGG - Intronic
1200112921 X:153752011-153752033 GTACTAGTCTGTGGCCTGTTAGG + Intergenic
1200304094 X:155007506-155007528 GTACTGGTCTGTGGCCTGTTAGG + Intronic
1200368508 X:155694932-155694954 GTACCAGTCTGTGGCCTGTTAGG - Intergenic
1200386452 X:155895785-155895807 GTACAGGTCTGTGGCTTGTTAGG + Intronic
1200439991 Y:3200988-3201010 GTACTGCTCTGTGGCCTGTTAGG + Intergenic
1200872774 Y:8121390-8121412 GTATCTGTCTGTGGCCTGTTAGG - Intergenic
1201052434 Y:9950752-9950774 GTATCTGTCTGTGGCCTGTTAGG - Intergenic
1201426855 Y:13860612-13860634 CTAACAGTCTGTGGTCTGTTAGG - Intergenic
1202101311 Y:21310486-21310508 GTACCTGTCCGCGGCCTGTTAGG - Intergenic
1202187192 Y:22197646-22197668 GTATCTGTCTGTGGCCTGTTAGG - Intergenic
1202204168 Y:22388750-22388772 GTATCTGTCTGTGGCCTGTTAGG + Intronic
1202241067 Y:22770573-22770595 GTATCTGTCTGTGGCCTGTTAGG + Intergenic
1202394053 Y:24404316-24404338 GTATCTGTCTGTGGCCTGTTAGG + Intergenic
1202476732 Y:25265776-25265798 GTATCTGTCTGTGGCCTGTTAGG - Intergenic