ID: 973272129

View in Genome Browser
Species Human (GRCh38)
Location 4:48271913-48271935
Sequence TGTGGACCAGTACCGGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973272129_973272133 -10 Left 973272129 4:48271913-48271935 CCTCAGACCGGTACTGGTCCACA No data
Right 973272133 4:48271926-48271948 CTGGTCCACAGCCTGCGGGTTGG No data
973272129_973272134 -9 Left 973272129 4:48271913-48271935 CCTCAGACCGGTACTGGTCCACA No data
Right 973272134 4:48271927-48271949 TGGTCCACAGCCTGCGGGTTGGG No data
973272129_973272138 9 Left 973272129 4:48271913-48271935 CCTCAGACCGGTACTGGTCCACA No data
Right 973272138 4:48271945-48271967 TTGGGGAACCCTGATTTAACAGG No data
973272129_973272135 -8 Left 973272129 4:48271913-48271935 CCTCAGACCGGTACTGGTCCACA No data
Right 973272135 4:48271928-48271950 GGTCCACAGCCTGCGGGTTGGGG 0: 1
1: 7
2: 46
3: 161
4: 490
973272129_973272139 10 Left 973272129 4:48271913-48271935 CCTCAGACCGGTACTGGTCCACA No data
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973272129 Original CRISPR TGTGGACCAGTACCGGTCTG AGG (reversed) Intergenic
No off target data available for this crispr