ID: 973272130

View in Genome Browser
Species Human (GRCh38)
Location 4:48271920-48271942
Sequence CGCAGGCTGTGGACCAGTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 2, 2: 23, 3: 98, 4: 277}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973272130_973272138 2 Left 973272130 4:48271920-48271942 CCGGTACTGGTCCACAGCCTGCG 0: 1
1: 2
2: 23
3: 98
4: 277
Right 973272138 4:48271945-48271967 TTGGGGAACCCTGATTTAACAGG No data
973272130_973272139 3 Left 973272130 4:48271920-48271942 CCGGTACTGGTCCACAGCCTGCG 0: 1
1: 2
2: 23
3: 98
4: 277
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973272130 Original CRISPR CGCAGGCTGTGGACCAGTAC CGG (reversed) Intergenic
901097955 1:6697654-6697676 CCCTGGCCATGGACCAGTACTGG - Intronic
901516827 1:9753335-9753357 CTCAGGACGTGGGCCAGTACTGG - Intronic
902938258 1:19780414-19780436 TCCAGGCCGTGGACCAGTACTGG - Intronic
903434357 1:23335395-23335417 AACAGGCCATGGACCAGTACGGG - Intronic
904484160 1:30813971-30813993 TGCAGGCTGTGGCCCAGAGCGGG - Intergenic
905829304 1:41052197-41052219 CCCAGGCTGAAGACCAATACGGG + Intronic
906864097 1:49397156-49397178 CCCAGGCCATGGACCAGTACTGG - Intronic
907029853 1:51160297-51160319 CCCAGGCCATGGACCAGTACTGG + Intergenic
907185595 1:52606907-52606929 GGCAGGATGGGCACCAGTACCGG - Exonic
907614179 1:55907077-55907099 CCCAGGCTGTGGACAGGTACTGG + Intergenic
907819110 1:57949407-57949429 CCCAGGCCACGGACCAGTACTGG - Intronic
908102456 1:60805539-60805561 TTCAGGCTGCGGACCGGTACCGG - Intergenic
908611733 1:65868664-65868686 CCCAGGCTGCAGACCAGTAGTGG + Intronic
909571340 1:77115368-77115390 CTCAGGTTGAGGACCAATACAGG - Intronic
910324554 1:85990581-85990603 CCTGGGCTGTGGACCTGTACTGG - Intronic
911134240 1:94422193-94422215 CCCGGGCTGTGGACTGGTACAGG + Intronic
912353227 1:109034502-109034524 AACAGGCTGTGGATCAGTATTGG - Intronic
912532421 1:110335894-110335916 CCCAGGCTGTGGACCAGTAATGG + Intergenic
916777829 1:167986768-167986790 AACAGGCTACGGACCAGTACTGG + Intronic
917417209 1:174822781-174822803 ACCAGGCAGCGGACCAGTACCGG - Intronic
917614902 1:176732861-176732883 CTCAGGCTATGGAGCAGTACTGG + Intronic
918031434 1:180816424-180816446 TCCAGGCCATGGACCAGTACTGG - Intronic
919615243 1:199799238-199799260 CCCAGGCAGTGGACCAGTATTGG + Intergenic
919852649 1:201683647-201683669 CCCAGGCCATGGACCAGTACTGG - Intronic
920550384 1:206855682-206855704 CCCAGGCCATGGACCAGTACCGG - Intergenic
921274044 1:213499665-213499687 CCCAGGCCATGGACCAGTACTGG - Intergenic
921525011 1:216206593-216206615 CCCAGGCTGTGGACAGGTACTGG - Intronic
923616708 1:235544420-235544442 CCCAGGCCGCGGACCAGTATGGG + Intergenic
924249188 1:242114522-242114544 CCCAGGCCAGGGACCAGTACTGG + Intronic
924407042 1:243758856-243758878 CCCAGCCTGTGGACAAGTACTGG - Intronic
1063205398 10:3826310-3826332 CGCAGGCTGTGGACCCCGATGGG + Intergenic
1065226511 10:23549059-23549081 CCCTGGCTGTGGACCGGTACTGG + Intergenic
1065361827 10:24896118-24896140 CCCAGGCTGTGGATTGGTACTGG + Intronic
1065939717 10:30553306-30553328 CCCAGGCCATAGACCAGTACTGG - Intergenic
1066196695 10:33106962-33106984 AGGCTGCTGTGGACCAGTACAGG + Intergenic
1067199621 10:44156020-44156042 CCCAGGCCATGGACCAGTACTGG - Intergenic
1067224627 10:44367579-44367601 CCCAGGCTGCAGACCAGTAGGGG + Intergenic
1068676330 10:59773380-59773402 CCCGGGCTGCAGACCAGTACTGG + Intergenic
1068836595 10:61561639-61561661 TCCAGGCTGTGGACCAGTATGGG - Intergenic
1068970917 10:62957230-62957252 CCCAGGCTGAGGTCCAGTACTGG - Intergenic
1070456804 10:76625037-76625059 GGGAGGCAGTGGACCAGGACTGG + Intergenic
1072059525 10:91796523-91796545 TACAGGCTAGGGACCAGTACCGG + Intergenic
1072238598 10:93474355-93474377 TCCAGGCTTTGGAACAGTACAGG - Intronic
1073232316 10:101982525-101982547 CCCAGGCCATGGACGAGTACTGG + Intronic
1073472376 10:103730954-103730976 CCCAGGCAGGGGACCAGCACAGG + Intronic
1075141551 10:119841931-119841953 CCCAGGCCGTGGACCAGTACTGG + Intronic
1075726092 10:124611632-124611654 CTGAGGCTGTGGACCTGGACGGG - Intronic
1075831622 10:125416983-125417005 ACCGGGCCGTGGACCAGTACTGG + Intergenic
1075831626 10:125416996-125417018 AACAGGCCGCGGACCAGTACTGG - Intergenic
1075848274 10:125564797-125564819 CCCAGGCCATGGACCAGTACAGG - Intergenic
1076915403 10:133420956-133420978 CACAGGCTGTGGACCCCTTCAGG - Exonic
1077769176 11:5196214-5196236 AGCAGGCCACGGACCAGTACTGG - Intergenic
1078064061 11:8066420-8066442 CACAGGCTGTGGAGCTGTACAGG - Intronic
1078099597 11:8322059-8322081 CCCAGGCTGCGGACCGGTACTGG + Intergenic
1078571819 11:12465117-12465139 AACAGGCCATGGACCAGTACTGG + Intronic
1080202138 11:29684462-29684484 CACAGTCTGTGGACTAGTACTGG - Intergenic
1080723612 11:34873034-34873056 TCCAGGCCGTGGACCTGTACTGG + Intronic
1080878574 11:36298680-36298702 CCCGGGCCATGGACCAGTACTGG - Intronic
1085238931 11:75036004-75036026 TGCAGGCTCTGGAGCAGAACTGG - Intergenic
1085382163 11:76129768-76129790 TGCAGGCTGTGCAGTAGTACAGG - Intronic
1085611544 11:77954830-77954852 CCCAGGCTGTGGACCAGTCCTGG - Intronic
1085938280 11:81176934-81176956 CCCAGGCTACAGACCAGTACTGG - Intergenic
1086359634 11:86044648-86044670 CCCAGGCCGTGGACCATTACTGG + Intronic
1087691702 11:101327681-101327703 AACAGGCTGTGGACTGGTACTGG + Intergenic
1089896307 11:121933523-121933545 CCCAGGCTGTGGGCTGGTACTGG - Intergenic
1091399326 12:172902-172924 CGCAGGCTGTGGCCCAGAGGGGG + Intronic
1092094900 12:5833571-5833593 AACAGGCCATGGACCAGTACCGG - Intronic
1092741620 12:11636003-11636025 CCCATGCCATGGACCAGTACTGG + Intergenic
1093224499 12:16465414-16465436 AACAGGCCATGGACCAGTACCGG - Intronic
1093846168 12:23973686-23973708 TCCAGGTTGTGGACCAGCACTGG + Intergenic
1094719136 12:33044495-33044517 CCCAGGCCATGGACCAGTACTGG - Intergenic
1095919051 12:47510857-47510879 CGCAGGCTCCTGACCAGCACAGG + Intergenic
1095950572 12:47779697-47779719 TCCAGGCTGTGGAACAGTAGTGG + Intronic
1096483414 12:51958851-51958873 AACAGGCCGTGGACCAGTACCGG + Intronic
1097115577 12:56694350-56694372 CCCAGGCTGTGGATAGGTACTGG + Intergenic
1098144504 12:67484949-67484971 AACAGGCCATGGACCAGTACAGG - Intergenic
1098157261 12:67612566-67612588 CCCTGGCCGAGGACCAGTACTGG + Intergenic
1099154581 12:79158498-79158520 TACAGGCCATGGACCAGTACTGG - Intronic
1100625576 12:96327975-96327997 AACAGGCCATGGACCAGTACTGG - Intronic
1100678019 12:96889036-96889058 AACAGGCCGTGGACCAATACCGG + Intergenic
1100678022 12:96889049-96889071 CCCAGGCTGTGGACCGGTATTGG - Intergenic
1100816643 12:98393113-98393135 AGCAGGCTGAGGATCAGAACTGG - Intergenic
1101375533 12:104168128-104168150 AACAGGCTGTGAACCAGTACTGG - Intergenic
1101470514 12:104992604-104992626 CCCAGGCTGTGGACTGGTACTGG + Intronic
1101721423 12:107353636-107353658 CCTGGGCTGTGGACCAGTAGGGG + Intronic
1101968633 12:109297147-109297169 TCCAGGCTGAGGACCAGTACTGG + Intronic
1102751289 12:115296863-115296885 CTCAGGCTGTGGACTGGTACTGG - Intergenic
1103338265 12:120206456-120206478 CTCAGGCCAAGGACCAGTACTGG - Intergenic
1104501872 12:129293883-129293905 CCTAGGCTATGGACCAGTATTGG - Intronic
1109654188 13:65368011-65368033 AACAGGCCATGGACCAGTACTGG + Intergenic
1109654191 13:65368024-65368046 CATAGGCCATGGACCAGTACTGG - Intergenic
1111160873 13:84393621-84393643 AGCAGGCTCTGGGCTAGTACTGG + Intergenic
1111592802 13:90371464-90371486 CCCAAGCTGTGGACCAGTACCGG - Intergenic
1112480768 13:99773336-99773358 CCCAGGCCATGGACCAGTACAGG + Intronic
1112767712 13:102763332-102763354 CCCGGGCTGCAGACCAGTACTGG + Intergenic
1112820743 13:103332099-103332121 AGCAGGCTTTGGACCAGTGATGG + Intergenic
1112939254 13:104841243-104841265 CCCTGGCTGTGGACCAGTTCTGG + Intergenic
1113300322 13:109012244-109012266 CACAGGCCGTGGACCAGTACTGG - Intronic
1117322200 14:54634656-54634678 AACAGGCTGTGGACCAGTACCGG + Intronic
1117458117 14:55918102-55918124 TGGGGGCTGTGGAACAGTACTGG + Intergenic
1119122220 14:72090275-72090297 CCCAGGCCATGGACCAGTACCGG + Intronic
1119345935 14:73924385-73924407 CCCAGGCCATGGACCAGCACTGG - Intronic
1119907272 14:78317259-78317281 CCCAGGCTGTGGACCAGTGGTGG + Intronic
1120248529 14:82033795-82033817 AGGAGGCTGTGGATCAATACGGG + Intergenic
1120347397 14:83308320-83308342 AACAGGCCATGGACCAGTACTGG + Intergenic
1120347399 14:83308333-83308355 CTCAGGTCATGGACCAGTACTGG - Intergenic
1121063693 14:90940693-90940715 CCCAGGCCATGGACAAGTACTGG + Intronic
1121078115 14:91085903-91085925 CCCAGGCCATGTACCAGTACTGG + Intronic
1121497081 14:94400224-94400246 CCCAGTCTGCAGACCAGTACCGG - Intergenic
1121549504 14:94788017-94788039 CTCAGGCTATGGGTCAGTACTGG - Intergenic
1121604573 14:95231066-95231088 CCCAGGCCATGGACCAGTACTGG + Intronic
1122376707 14:101265723-101265745 TGCAAGCTGTGGCGCAGTACTGG - Intergenic
1122893660 14:104744677-104744699 CCTGGGCTGTGGACCAGTACTGG - Intronic
1123208424 14:106736165-106736187 ATCAGGCTGCTGACCAGTACGGG + Intergenic
1126118182 15:45227795-45227817 CCCAGGCCATGGACCAGTACTGG + Intergenic
1126511012 15:49474657-49474679 AACAGGCCATGGACCAGTACCGG - Intronic
1127863369 15:63012552-63012574 AGCAGGCCATGGACCAGTACCGG - Intergenic
1127901050 15:63341275-63341297 CCCAGGCTGTGGACCAGTACCGG + Intronic
1128213557 15:65918437-65918459 AGAAGGCTGTGGAACAGTACAGG - Intronic
1128876672 15:71207557-71207579 CCTGGGCTGTGGACCAGTACTGG + Intronic
1128876674 15:71207570-71207592 AACAGGCTGCGGCCCAGTACTGG - Intronic
1129779571 15:78261512-78261534 CCTAGGCTGCGGACCAGTACTGG + Intergenic
1130076104 15:80691904-80691926 CCCGGGCCGTGGACCTGTACTGG + Intronic
1130227903 15:82073618-82073640 CCCAGGCCATGCACCAGTACAGG - Intergenic
1130779645 15:87021988-87022010 ACCAGGCTCTGGGCCAGTACTGG - Intronic
1130781033 15:87041621-87041643 CCCAGGCTGTGGACTGGTACTGG + Intergenic
1131308768 15:91268950-91268972 CCCAGGCTTTGGACTAGTTCGGG - Intronic
1131325519 15:91439819-91439841 CTCAGGCTATGGACTGGTACTGG - Intergenic
1131960684 15:97787406-97787428 CCCAGGCCCTGGATCAGTACTGG - Intergenic
1132572061 16:648523-648545 CCCAGGCTGTGGACTGGAACTGG - Intronic
1137322911 16:47403867-47403889 CCCAGGCCATGGACCAGAACTGG + Intronic
1137325493 16:47431216-47431238 CTTGGGCTGTGGACCACTACAGG + Intronic
1137408659 16:48209610-48209632 AACAGGCTGTGGACCAGTGCAGG + Intronic
1137673258 16:50291510-50291532 CACAGGCAGTGGATCAGCACAGG + Intronic
1138146724 16:54619301-54619323 CCCAGGCTGTGAACCACTACTGG - Intergenic
1139375086 16:66491890-66491912 CCCAGGCCTTGGACCAGTACTGG - Intronic
1139472199 16:67184256-67184278 CGCAGCCCGTGTACCAGGACGGG + Intergenic
1139558648 16:67728255-67728277 AGGAGGCTGTGGACCAGGTCTGG + Intronic
1139952063 16:70677366-70677388 CGCAGGCTGTGGGACAGGACTGG + Intronic
1140239206 16:73185823-73185845 GACAGGCCATGGACCAGTACTGG - Intergenic
1141836517 16:86543750-86543772 CACAGGCCATGGACTAGTACTGG - Intronic
1141870055 16:86779121-86779143 CGCAGGCTGTGGAGGTGGACAGG - Intergenic
1144557866 17:16297854-16297876 CCCAGGCTGCAGACCAGTACAGG + Intronic
1149290680 17:55215151-55215173 TCCAGGCTGTGGACCAGTACTGG - Intergenic
1149314677 17:55427873-55427895 CCCAGGCTGTGGACTGGTACCGG + Intergenic
1150307252 17:64096104-64096126 CCCAGGTTGTGGACCCATACTGG + Intronic
1150498259 17:65625806-65625828 CCCGGGCTGAGGACCTGTACTGG + Intronic
1152300865 17:79494833-79494855 CTCAGGCTGTGGCCCTGGACCGG - Intronic
1154368848 18:13738998-13739020 AACAGGCCGTGGACCTGTACTGG + Intronic
1155164362 18:23220598-23220620 TGCTGGCTCGGGACCAGTACAGG + Intronic
1156350052 18:36296065-36296087 AACAGGCTACGGACCAGTACCGG - Intergenic
1157472508 18:48000794-48000816 CCTAGGCCATGGACCAGTACTGG + Intergenic
1157994532 18:52539373-52539395 CCCAGGCCGTGGACTAGTATTGG + Intronic
1158584373 18:58718359-58718381 CCCAGGCTGTGGACCAGAACTGG + Intronic
1158967179 18:62632714-62632736 CGCAGGCCATAGTCCAGTACTGG - Intergenic
1159031169 18:63233704-63233726 CCCAGGCCATGGACCGGTACAGG - Intronic
1159985320 18:74834697-74834719 CGCAGGCTGAGCACTAGTGCAGG + Intronic
1161152578 19:2717381-2717403 CGCAGGCGGTGGCCCAGGAGTGG - Exonic
1162688572 19:12409356-12409378 TCCAGGCTGTGGACCAGTACTGG - Intronic
1163067768 19:14811913-14811935 AACAGGCTGTGGACCAGTACTGG + Intronic
1163569075 19:18069601-18069623 GGCAGCCTGTGGGCCAGGACGGG - Exonic
1165124547 19:33584370-33584392 CCCAGGCCATGGACTAGTACTGG - Intergenic
1165235870 19:34421147-34421169 CCCAGGCCATGGACCAGTACTGG - Intronic
1165671129 19:37680330-37680352 CACAGGCCAAGGACCAGTACTGG + Intronic
1165756753 19:38297856-38297878 AACAGGCTGGGGACCGGTACTGG + Intronic
1165788491 19:38476675-38476697 CCCAGGCTGTGGGCTGGTACTGG - Intronic
1168060812 19:53891101-53891123 GGGAGGCTGTGGTTCAGTACTGG + Intronic
925529310 2:4842008-4842030 AACAGGCCATGGACCAGTACTGG + Intergenic
925529313 2:4842021-4842043 CCCAGGCTGTGGACCAGTACTGG - Intergenic
925590971 2:5508971-5508993 AACAGGCCATGGACCAGTACTGG - Intergenic
925624205 2:5825989-5826011 CCCAGGCTGAGGACCACTACTGG - Intergenic
926995453 2:18730290-18730312 AACAGGCCATGGACCAGTACCGG - Intergenic
927132253 2:20070648-20070670 GACAGGCCATGGACCAGTACTGG + Intergenic
927924103 2:26997641-26997663 CCCAGGCTGTGGACTAGTACGGG - Intronic
928295567 2:30080011-30080033 AGCAGGCCATGGACCAGTACTGG - Intergenic
928477485 2:31644656-31644678 CACAGGCTGTGGACTGGTACGGG - Intergenic
929239892 2:39643239-39643261 CCCAGGCCATGGACCAGTACTGG + Intergenic
929813967 2:45216180-45216202 CCTGGGCTGTGGACCAGTACTGG - Intergenic
930359413 2:50358897-50358919 TGGAGGCTGTGGAACAGTAAAGG - Intronic
931731055 2:65153803-65153825 CTCAGGTTGTGGACTGGTACTGG - Intergenic
932540780 2:72649995-72650017 AACAGGCTATGGACCGGTACTGG - Intronic
932713611 2:74085757-74085779 CCCAGGGTGCGGACCTGTACTGG - Intronic
932748427 2:74354735-74354757 CCCTGGCTATGGACTAGTACTGG - Intronic
934876103 2:97922315-97922337 CCCATGCCATGGACCAGTACCGG - Intronic
934941964 2:98509222-98509244 CCCGGGCTGCAGACCAGTACTGG + Intronic
935183384 2:100709622-100709644 CCCAGACCGTGGACCAGTATAGG + Intergenic
935565209 2:104598957-104598979 CCTAGGCCATGGACCAGTACTGG - Intergenic
936053531 2:109243254-109243276 CGCCGGCTCTGGCCCAGGACTGG - Intronic
936098334 2:109551947-109551969 CCCAGGCCGCGGACCAGTACTGG + Intronic
936098338 2:109551960-109551982 AACAGGCCATGGACCAGTACTGG - Intronic
936689672 2:114871728-114871750 CCCAGGCCATGGACCAGAACTGG + Intronic
937196467 2:120161671-120161693 AACAGGCCATGGACCAGTACCGG - Intronic
937290456 2:120778660-120778682 AGCAGGCTGGGGGCCAGTCCAGG + Intronic
938904843 2:135827791-135827813 AACAGGCCATGGACCAGTACTGG + Intronic
938904846 2:135827804-135827826 CCCAGGCGGAGCACCAGTACTGG - Intronic
939291638 2:140203612-140203634 AACAGGCCATGGACCAGTACAGG + Intergenic
940769526 2:157825421-157825443 CCCAGGCTGTGGACGGGTACTGG + Intronic
941327857 2:164140077-164140099 CCCAAGCTGCAGACCAGTACCGG - Intergenic
941398687 2:165003806-165003828 CCCAGGCTGCGTACCGGTACTGG + Intergenic
942420442 2:175801574-175801596 AATAGGCTGTGGACCAGTACCGG + Intergenic
943156645 2:184187770-184187792 AACAGGCCATGGACCAGTACTGG + Intergenic
943663634 2:190585770-190585792 CTCAGGCTGAGGAGCAGTCCAGG + Intergenic
946207932 2:218124293-218124315 TTCAGGCTTTGGACCAGTAGGGG + Intergenic
948340914 2:237250897-237250919 CCCAGGCCCTGGACCAGTAATGG + Intergenic
1169417068 20:5426255-5426277 CCCATGCTGTGGACCAGTACTGG - Intergenic
1171365691 20:24622427-24622449 AACAGGCCATGGACCAGTACTGG - Intronic
1172306697 20:33885656-33885678 CCCTGGCCATGGACCAGTACTGG + Intergenic
1173095617 20:40025310-40025332 CCCAGGCTGTGGACTGGTACTGG - Intergenic
1174623458 20:51894873-51894895 CCCAGGCCGTGGACAGGTACTGG - Intergenic
1174714809 20:52746356-52746378 AACAGGCCATGGACCAGTACCGG - Intergenic
1174868884 20:54165119-54165141 CCCAGGCCGTGAACCAGTACTGG + Intronic
1175023563 20:55877135-55877157 CCCAGGCCGTGGACTAGTACTGG - Intergenic
1175211685 20:57361852-57361874 CCCAGGCTGTGGACCAGAACAGG + Intronic
1176036836 20:63043763-63043785 CGCAGTCTCTGGACCAGGCCAGG + Intergenic
1178252170 21:31014067-31014089 TGTAGTCTGTGGACCAGTGCTGG - Intergenic
1179046598 21:37850313-37850335 CCCAGGCCGTGGACCAATACTGG + Intronic
1180714811 22:17864651-17864673 GGCAGGCTGTGGCCCAGTGATGG - Intronic
1181635648 22:24173136-24173158 CACAGGCTGTGGGCCAGTGCAGG - Intronic
1181970256 22:26684411-26684433 CGGAGGCTGTGGAGGAGTCCAGG + Intergenic
1183507919 22:38219783-38219805 CACAGGCTGAGGACCAGCCCTGG - Exonic
1184322099 22:43749698-43749720 CCCAGGCTGCAGACCTGTACTGG - Intronic
1184877373 22:47284132-47284154 GGCAGCCTGTGGTCCAGAACAGG + Intergenic
949360974 3:3231665-3231687 AGAAGGCTGTGCACAAGTACAGG + Intergenic
949403835 3:3693962-3693984 CCCAGGCTGTGAACTGGTACTGG + Intergenic
950250216 3:11458782-11458804 CCCAGGCCATGGACCAGTACTGG + Intronic
952162972 3:30714258-30714280 AACAGGCCATGGACCAGTACAGG - Intergenic
952248667 3:31627128-31627150 CCCAGGCAGCGGACCAGCACTGG + Intronic
952435928 3:33272429-33272451 CCAAGGCTATGGACCAATACTGG + Intergenic
953162461 3:40433861-40433883 GCCAGGCAGTAGACCAGTACTGG - Intergenic
953309915 3:41866633-41866655 ACCGGGCTGTGGACCAGGACTGG - Intronic
953678625 3:45022680-45022702 TCCAGGCTATGGACCAGTACTGG - Intronic
955477480 3:59353109-59353131 ACCAGGCTGTGGACTGGTACTGG + Intergenic
956213836 3:66827940-66827962 CCCTGGCTATGGACCAGTACCGG - Intergenic
956273785 3:67476172-67476194 CCCAAGCCATGGACCAGTACTGG + Intronic
956273789 3:67476185-67476207 AACAGGCCATGGACCAGTACTGG - Intronic
957384599 3:79479490-79479512 CTTGGGCTGTGGACCAGTACAGG - Intronic
957654544 3:83058184-83058206 CCCAGGCTGGGGACAAGTACTGG + Intergenic
957668063 3:83262412-83262434 CCCCTGGTGTGGACCAGTACTGG + Intergenic
959822174 3:110749134-110749156 CCCAGGCCATGGACCTGTACTGG + Intergenic
960218730 3:115077078-115077100 CCCAGGCTGCAGACCAGTAATGG - Intronic
962982507 3:140503422-140503444 CCTAGGCTATGGACCTGTACAGG - Intronic
963305551 3:143648539-143648561 CCCAGGCTGTGGACCGGCACTGG - Intronic
965791787 3:172396541-172396563 CCCAGGCCGGGTACCAGTACTGG + Intronic
968204825 3:196790025-196790047 CCAGGGCCGTGGACCAGTACAGG - Intronic
969470233 4:7383265-7383287 AGCAGGCTGTGGACCTCTAAAGG - Intronic
970337026 4:15058693-15058715 CCTGGGCAGTGGACCAGTACTGG + Intronic
970456977 4:16234223-16234245 CTAAGGCTTTGTACCAGTACCGG - Intergenic
970593421 4:17578315-17578337 GGTAGGCTGTGGCACAGTACTGG - Intronic
972269892 4:37501220-37501242 CACAGGCCATGGATCAGTACTGG + Intronic
972675119 4:41252565-41252587 CCCAGGCTGAGGACTGGTACAGG - Intergenic
973239532 4:47942587-47942609 CCCGGGCTGTGGGCCGGTACTGG + Intronic
973272130 4:48271920-48271942 CGCAGGCTGTGGACCAGTACCGG - Intergenic
973829863 4:54747785-54747807 AACAGGCCATGGACCAGTACCGG + Intergenic
973977861 4:56281095-56281117 CCCAGGTGGTGAACCAGTACCGG + Intronic
974009170 4:56591990-56592012 CCTAGGCTGTGGACCAATACCGG + Intronic
975343847 4:73271783-73271805 CCCAGGCTGCAGATCAGTACTGG - Intergenic
976002343 4:80387482-80387504 CGCTGGCTGTGGGCCAGGCCTGG + Intronic
976869087 4:89768799-89768821 AACAGGCTATGGACCAGTACTGG + Intronic
977027090 4:91833364-91833386 CCTATGCTGTGAACCAGTACTGG - Intergenic
977305972 4:95324125-95324147 CCCAGGCCAGGGACCAGTACTGG + Intronic
977817507 4:101431891-101431913 AACAGGCCATGGACCAGTACCGG + Intronic
978291967 4:107152397-107152419 CCCGGGCAGTGGACCACTACTGG - Intronic
979423776 4:120539112-120539134 CCCAGGCTGCAGACCAGTACTGG + Intergenic
979700900 4:123666703-123666725 CCCAGGCCGTGGACCAGCACTGG - Intergenic
982015531 4:151149786-151149808 CTCAGGCTGTGGTCCACAACAGG - Intronic
982878837 4:160685648-160685670 CCCAGGCTGTGTTCCACTACAGG - Intergenic
983040832 4:162923800-162923822 GCTGGGCTGTGGACCAGTACTGG + Intergenic
983040833 4:162923813-162923835 ATCAGGCTATGGACCAGTACTGG - Intergenic
983330108 4:166315857-166315879 CTCAGGCCATGGACCAGTAGTGG + Intergenic
983354131 4:166633342-166633364 CCCAGGCCATGGACCAGTACTGG - Intergenic
985636860 5:1039978-1040000 CCCAGGCTGTGGACTGCTACTGG + Intergenic
988950010 5:36246475-36246497 CCCGAGCTGTGGACCAGTATCGG + Intergenic
989469186 5:41795317-41795339 CCTGGGCTGTGGACCAGTACCGG - Intronic
989472527 5:41836817-41836839 CTCAGGCCATGGACCTGTACTGG - Intronic
989628803 5:43460275-43460297 CCCAGGCCATGGACCAGTACAGG - Intronic
990275655 5:54193368-54193390 CCCAGGCAGTGAACCGGTACTGG + Intronic
990275658 5:54193381-54193403 AACAGGCCATGGACCAGTACCGG - Intronic
990491086 5:56303698-56303720 CCCAGGCCTTGGACCAGTATTGG - Intergenic
990572846 5:57095778-57095800 ACCAGGCTCTGGGCCAGTACTGG - Intergenic
991084431 5:62635647-62635669 CCCAGGCTGCAGACCTGTACTGG + Intergenic
991625537 5:68596950-68596972 CCTGGGCTGTGGACCTGTACTGG - Intergenic
992211415 5:74483570-74483592 CCCAGGCTGGGGACCCTTACTGG + Intergenic
993859981 5:93124382-93124404 AACAGGCTGTGGACAGGTACTGG - Intergenic
993913149 5:93708694-93708716 CAGAGGCCATGGACCAGTACTGG - Intronic
994479991 5:100322513-100322535 CGCAGGCCATGGACCAGTACTGG + Intergenic
994610832 5:102037141-102037163 CCCAGGCTGTGTACTGGTACTGG - Intergenic
995746367 5:115408245-115408267 CCCAGGCTGTGGACTAGTACTGG + Intergenic
996322150 5:122230755-122230777 CCCGGGCCGTGGACCAGTACTGG - Intergenic
996432244 5:123394555-123394577 CTCAGGCTGCGGACTGGTACAGG - Intronic
996962207 5:129264585-129264607 CCCAGGCCATGGACCAGTACTGG + Intergenic
997840298 5:137233568-137233590 CCCAGGCCATGGACTAGTACTGG - Intronic
1001350186 5:170954880-170954902 AACAGGCTGTGGACCAGTACAGG - Intronic
1001538101 5:172513880-172513902 CCTGGGCTGTGGACCAGTACTGG + Intergenic
1002954164 6:1845871-1845893 AACAGGCCATGGACCAGTACTGG + Intronic
1004897110 6:20159158-20159180 CCCAGGCCATGGGCCAGTACTGG + Intronic
1004897114 6:20159171-20159193 AACAGGCCATGGACCAGTACTGG - Intronic
1004897280 6:20161004-20161026 AACAGGCCATGGACCAGTACTGG - Intronic
1005680855 6:28207072-28207094 CTCAGGCAGTGCTCCAGTACTGG + Intergenic
1005990666 6:30899788-30899810 CCCAAGCTGAGGACAAGTACAGG - Intronic
1006041765 6:31261898-31261920 CCCCGGCTGTGGACTGGTACAGG + Intergenic
1009052240 6:58290062-58290084 AACAGGCCATGGACCAGTACCGG + Intergenic
1009517775 6:64641673-64641695 CCCAGGCTGGGGACTGGTACAGG + Intronic
1010601174 6:77828250-77828272 ACCAGGCCATGGACCAGTACTGG + Intronic
1010601178 6:77828263-77828285 AACAGGCCATGGACCAGTACTGG - Intronic
1010776627 6:79894036-79894058 CCCAGGCTGTGGACCTGTACCGG + Intergenic
1013160614 6:107540571-107540593 CACAGGCTGTGGGCCAGAGCTGG + Intronic
1013227106 6:108127763-108127785 CCCAGGCCATGGACAAGTACTGG - Intronic
1013355907 6:109345842-109345864 CCCAGGCTGTGGACCGGCAGGGG + Intergenic
1014102827 6:117530533-117530555 CCCAGGCTGTGGACTGGTACTGG - Intronic
1014108947 6:117598766-117598788 CCCGGGCTGTGGACCAGTACTGG - Intronic
1017737140 6:157375574-157375596 AACAGGCCGTGGACCAGTACTGG - Intergenic
1018058467 6:160071631-160071653 CTCAGGCTGAGGAACAGGACAGG - Intronic
1018664727 6:166125229-166125251 AACAGGCCATGGACCAGTACCGG + Intergenic
1019163974 6:170087171-170087193 CCCAGGCTGGGGAACAGCACCGG + Intergenic
1019949680 7:4361367-4361389 CCCAGGTCATGGACCAGTACTGG - Intergenic
1022914594 7:34934864-34934886 CCCCGGCCATGGACCAGTACTGG - Intronic
1022983439 7:35626294-35626316 CCCAGGCTGTGAACCAGTACTGG + Intergenic
1024761522 7:52602681-52602703 ACTAGGCAGTGGACCAGTACAGG + Intergenic
1024780841 7:52846504-52846526 CCTGGGCTGTGGACCAGTACTGG - Intergenic
1025841551 7:65154221-65154243 CCCAGGCTGTGGACCAGTCCTGG + Intergenic
1025881498 7:65541745-65541767 CCCAGGCTGTGGACCAGTCCTGG - Intergenic
1025891941 7:65660870-65660892 CCCAGGCTGTGGACCAGTCCTGG + Intergenic
1026914156 7:74109878-74109900 CCCAGGGTGTGGTCCAGCACAGG - Intronic
1026990680 7:74583627-74583649 CCCAGGCGGTGGACCAGAAGTGG - Intronic
1027395080 7:77746071-77746093 GACAGGCTATGGACCAGTACCGG + Intronic
1028232124 7:88318408-88318430 CGAAGGGTGTGGGCCACTACAGG - Intergenic
1029531050 7:101125592-101125614 AACAGGCTATGGACCAGTACGGG - Intergenic
1030263352 7:107589622-107589644 GACAGGCCGTGGAGCAGTACAGG + Intronic
1030670160 7:112326434-112326456 CTCAGGCTGTGGAAGAGTTCAGG - Intronic
1030743838 7:113141095-113141117 CCCAGGCCGTGGACTGGTACTGG + Intergenic
1031135806 7:117882795-117882817 AACAGGCCATGGACCAGTACTGG + Intergenic
1032698922 7:134361777-134361799 AACAGGCTATGGACCAGAACTGG - Intergenic
1032766303 7:134997304-134997326 CACAGGCCATAGACCAGTACTGG + Intronic
1032766306 7:134997317-134997339 CTGAGGCCATGGACCAGTACTGG - Intronic
1033138100 7:138801428-138801450 CCCAGGCTGAGGGCCAGTTCTGG - Intronic
1033488133 7:141812025-141812047 TGCAGGCTGTGGCCAAGAACAGG + Intergenic
1033916085 7:146328038-146328060 AACAGGCCATGGACCAGTACCGG - Intronic
1034135264 7:148762071-148762093 CGCTGGCTGTGGGCCAGTATGGG - Intronic
1034729969 7:153378572-153378594 CCCAGGCCATGGACCAGTACTGG - Intergenic
1035901545 8:3462348-3462370 AGCAGGCCATGGACGAGTACTGG - Intronic
1036736032 8:11317604-11317626 CCCAGGCCATGGACCAGTAAGGG - Intronic
1036966276 8:13301669-13301691 CCCAAGCCCTGGACCAGTACCGG + Intronic
1037954005 8:23039273-23039295 CCCAGGCCATGGACCAGTACTGG - Intronic
1038724452 8:30068131-30068153 AACAGGCCGTGGAGCAGTACTGG - Intronic
1038730826 8:30126179-30126201 AACAGGCTGTGGATCAGCACTGG + Intronic
1039618824 8:38978178-38978200 CATGGGCTGTGGACCAGTACAGG + Intronic
1041303157 8:56434211-56434233 ACCAGGCCATGGACCAGTACTGG + Intergenic
1041303162 8:56434224-56434246 CCCAGGCCACGGACCAGTACTGG - Intergenic
1041702868 8:60810824-60810846 CCCAGGCCATGGATCAGTACTGG + Intronic
1042145867 8:65729984-65730006 CCCAGGCCATGGACCGGTACTGG + Intronic
1042145871 8:65729997-65730019 AACAGGCCATGGACCAGTACCGG - Intronic
1042378290 8:68081375-68081397 CCCAGGCTGCGGACCAGTATGGG - Intronic
1042827597 8:72994200-72994222 CCCAGGCCGTGGACTAGTACTGG - Intergenic
1042910870 8:73824840-73824862 CCCATGCTGTGGACTAGTACTGG - Intronic
1043190844 8:77221130-77221152 CACAGACAGTGGACCAGTCCAGG + Intergenic
1043772806 8:84226015-84226037 CCCTGGCTGTGGACCAGTACTGG + Intronic
1044860120 8:96514877-96514899 AACAGGCCATGGACCAGTACTGG + Intronic
1045098302 8:98821092-98821114 AACAGGCCATGGACCAGTACTGG - Intronic
1045672436 8:104571245-104571267 CCCAGGCTGCAGACCAGTAATGG + Intronic
1045984644 8:108235554-108235576 CCCAGGTCATGGACCAGTACCGG - Intronic
1047177847 8:122558309-122558331 AACAGGCCATGGACCAGTACTGG + Intergenic
1047177851 8:122558322-122558344 TCCAGGCCTTGGACCAGTACTGG - Intergenic
1047891379 8:129315154-129315176 CCCGGGCCATGGACCAGTACTGG + Intergenic
1048383357 8:133888288-133888310 AGCAGGCCATGGACCAGTACTGG + Intergenic
1048383361 8:133888301-133888323 CCCAGGCCACGGACCAGTACTGG - Intergenic
1048780720 8:137997088-137997110 AACAGGCCATGGACCAGTACTGG - Intergenic
1049362071 8:142216590-142216612 CCCAGGCTGCTGACCAGTGCGGG - Intronic
1049626061 8:143622009-143622031 CCCAGGCTATGGACCAGTTCCGG - Intergenic
1049758595 8:144321741-144321763 CTCTGGCTGTGGACTAGCACTGG + Intronic
1049854775 8:144854382-144854404 CTCAGGCTGTGGACCGCTACAGG + Intergenic
1051432022 9:16988964-16988986 CGGAGGCTGTGGAACAGAAATGG - Intergenic
1052699459 9:31920555-31920577 AACAGGCCATGGACCAGTACTGG - Intergenic
1052811369 9:33063547-33063569 AACAGGCCGTGGACCAGTACTGG - Intronic
1053173832 9:35908634-35908656 AGCAGGCTGTGGGCCATGACAGG - Intergenic
1055546605 9:77380964-77380986 AACAGGCTATGGACCGGTACTGG + Intronic
1055824346 9:80305889-80305911 CTCGGGCTGTGTACCAGTACTGG + Intergenic
1057205090 9:93167027-93167049 AGGAGGCTGTGCACCAGCACCGG - Intergenic
1058646097 9:107132698-107132720 AACAGGCTGTGGACTGGTACCGG - Intergenic
1059377791 9:113899375-113899397 TCCAGGCTGCAGACCAGTACAGG + Intronic
1061505226 9:131028018-131028040 AACAGGCCATGGACCAGTACCGG - Intronic
1061682844 9:132251522-132251544 AGCAGGCCATGGACCGGTACTGG + Intergenic
1185800494 X:3006311-3006333 AACAGGCTACGGACCAGTACTGG + Intergenic
1185800497 X:3006324-3006346 CCCTGGCCATGGACCAGTACTGG - Intergenic
1186376213 X:9004617-9004639 AGCAAGCTATGGACCAGTAATGG + Intergenic
1186565166 X:10654679-10654701 CCCAGGCCATGGACTAGTACCGG - Intronic
1186577420 X:10781018-10781040 AACAGGCCATGGACCAGTACCGG + Intronic
1188334613 X:28915268-28915290 CCCAGGCTGTGGACTGGTACTGG - Intronic
1188972660 X:36636643-36636665 CCCAGGATTTGGACCAGTACTGG + Intergenic
1192356706 X:70410821-70410843 CCTAGGCTGGGGACCAGTACTGG - Intronic
1194592448 X:95815900-95815922 AACAGGCTATGGACCGGTACTGG + Intergenic
1195124265 X:101790039-101790061 CCCAGGTCATGGACCAGTACTGG + Intergenic
1195892138 X:109707582-109707604 AACAGGCCATGGACCAGTACCGG + Intronic
1195944229 X:110192059-110192081 CCCGGGCCGTGGACCAGAACTGG - Intergenic
1196032707 X:111108417-111108439 AACAGACTGTGGACCAGCACTGG - Intronic
1197976009 X:132166663-132166685 CTCAGGCTGTGGACTGGTACAGG + Intergenic
1198375428 X:136034120-136034142 CCCGGGCCGCGGACCAGTACTGG + Intronic
1199505190 X:148553559-148553581 CTCAGGCTGTGAATGAGTACAGG + Intronic
1200019460 X:153189590-153189612 CATGGGCCGTGGACCAGTACTGG + Intergenic
1200386448 X:155895769-155895791 CCCAGGCTGCAGACCGGTACAGG + Intronic
1201436681 Y:13966407-13966429 CCCAGGCTGTGGACTGGTCCTGG + Intergenic
1201514565 Y:14805137-14805159 CCCAGGCTATGGTCCAGTACTGG - Intronic