ID: 973272136

View in Genome Browser
Species Human (GRCh38)
Location 4:48271931-48271953
Sequence GTTCCCCAACCCGCAGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973272136_973272144 30 Left 973272136 4:48271931-48271953 CCACAGCCTGCGGGTTGGGGAAC No data
Right 973272144 4:48271984-48272006 ACAACAACTGAGGGTCAGAGAGG No data
973272136_973272138 -9 Left 973272136 4:48271931-48271953 CCACAGCCTGCGGGTTGGGGAAC No data
Right 973272138 4:48271945-48271967 TTGGGGAACCCTGATTTAACAGG No data
973272136_973272143 21 Left 973272136 4:48271931-48271953 CCACAGCCTGCGGGTTGGGGAAC No data
Right 973272143 4:48271975-48271997 ATAACAGCAACAACAACTGAGGG No data
973272136_973272142 20 Left 973272136 4:48271931-48271953 CCACAGCCTGCGGGTTGGGGAAC No data
Right 973272142 4:48271974-48271996 AATAACAGCAACAACAACTGAGG 0: 1
1: 0
2: 10
3: 94
4: 706
973272136_973272139 -8 Left 973272136 4:48271931-48271953 CCACAGCCTGCGGGTTGGGGAAC No data
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973272136 Original CRISPR GTTCCCCAACCCGCAGGCTG TGG (reversed) Intergenic
No off target data available for this crispr