ID: 973272139

View in Genome Browser
Species Human (GRCh38)
Location 4:48271946-48271968
Sequence TGGGGAACCCTGATTTAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973272127_973272139 19 Left 973272127 4:48271904-48271926 CCTAACAGACCTCAGACCGGTAC 0: 1
1: 3
2: 48
3: 388
4: 807
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data
973272129_973272139 10 Left 973272129 4:48271913-48271935 CCTCAGACCGGTACTGGTCCACA No data
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data
973272136_973272139 -8 Left 973272136 4:48271931-48271953 CCACAGCCTGCGGGTTGGGGAAC No data
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data
973272130_973272139 3 Left 973272130 4:48271920-48271942 CCGGTACTGGTCCACAGCCTGCG 0: 1
1: 2
2: 23
3: 98
4: 277
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data
973272125_973272139 26 Left 973272125 4:48271897-48271919 CCAGGTTCCTAACAGACCTCAGA No data
Right 973272139 4:48271946-48271968 TGGGGAACCCTGATTTAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973272139 Original CRISPR TGGGGAACCCTGATTTAACA GGG Intergenic
No off target data available for this crispr