ID: 973279167

View in Genome Browser
Species Human (GRCh38)
Location 4:48341527-48341549
Sequence ATCTGCGCCGGCTCCGGGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 27}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973279167_973279179 19 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279179 4:48341569-48341591 CAGCGGCGCTTTGGAACCCGAGG 0: 1
1: 0
2: 0
3: 5
4: 23
973279167_973279174 -6 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279174 4:48341544-48341566 GCAGATGAGGCAGTTCGGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 104
973279167_973279182 24 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279182 4:48341574-48341596 GCGCTTTGGAACCCGAGGTGGGG 0: 1
1: 0
2: 0
3: 12
4: 72
973279167_973279176 2 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279176 4:48341552-48341574 GGCAGTTCGGCTGGGGCCAGCGG 0: 1
1: 0
2: 3
3: 30
4: 427
973279167_973279175 -5 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279175 4:48341545-48341567 CAGATGAGGCAGTTCGGCTGGGG 0: 1
1: 1
2: 0
3: 9
4: 159
973279167_973279183 25 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279183 4:48341575-48341597 CGCTTTGGAACCCGAGGTGGGGG 0: 1
1: 0
2: 1
3: 12
4: 104
973279167_973279181 23 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279181 4:48341573-48341595 GGCGCTTTGGAACCCGAGGTGGG 0: 1
1: 0
2: 2
3: 19
4: 359
973279167_973279180 22 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279180 4:48341572-48341594 CGGCGCTTTGGAACCCGAGGTGG 0: 1
1: 0
2: 2
3: 26
4: 467
973279167_973279173 -7 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279173 4:48341543-48341565 CGCAGATGAGGCAGTTCGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 68
973279167_973279184 26 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279184 4:48341576-48341598 GCTTTGGAACCCGAGGTGGGGGG 0: 1
1: 1
2: 19
3: 461
4: 6499
973279167_973279177 10 Left 973279167 4:48341527-48341549 CCAATCCCGGAGCCGGCGCAGAT 0: 1
1: 0
2: 0
3: 7
4: 27
Right 973279177 4:48341560-48341582 GGCTGGGGCCAGCGGCGCTTTGG 0: 1
1: 0
2: 2
3: 18
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973279167 Original CRISPR ATCTGCGCCGGCTCCGGGAT TGG (reversed) Exonic