ID: 973287389

View in Genome Browser
Species Human (GRCh38)
Location 4:48433731-48433753
Sequence GCCCAGAAGTCCAAGGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973287389_973287394 21 Left 973287389 4:48433731-48433753 CCTGTAACCTTGGACTTCTGGGC No data
Right 973287394 4:48433775-48433797 CTCCCCAGTTGCAGAATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973287389 Original CRISPR GCCCAGAAGTCCAAGGTTAC AGG (reversed) Intergenic
No off target data available for this crispr