ID: 973287945

View in Genome Browser
Species Human (GRCh38)
Location 4:48440428-48440450
Sequence AGGGAGAGCACAGTGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973287945_973287957 19 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287957 4:48440470-48440492 TCTCTCTGCTGCCAGGGGATGGG No data
973287945_973287953 12 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287953 4:48440463-48440485 GAGGTTCTCTCTCTGCTGCCAGG No data
973287945_973287954 13 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287954 4:48440464-48440486 AGGTTCTCTCTCTGCTGCCAGGG No data
973287945_973287955 14 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287955 4:48440465-48440487 GGTTCTCTCTCTGCTGCCAGGGG No data
973287945_973287959 29 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287959 4:48440480-48440502 GCCAGGGGATGGGGAATGAATGG No data
973287945_973287958 20 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287958 4:48440471-48440493 CTCTCTGCTGCCAGGGGATGGGG No data
973287945_973287947 -7 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287947 4:48440444-48440466 TCTCCCTCCCCAAAGCACAGAGG No data
973287945_973287956 18 Left 973287945 4:48440428-48440450 CCCACAGTCACTGTGCTCTCCCT No data
Right 973287956 4:48440469-48440491 CTCTCTCTGCTGCCAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973287945 Original CRISPR AGGGAGAGCACAGTGACTGT GGG (reversed) Intergenic