ID: 973294068

View in Genome Browser
Species Human (GRCh38)
Location 4:48496090-48496112
Sequence GCTGCACTAAAAGGTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973294058_973294068 26 Left 973294058 4:48496041-48496063 CCTCCTGGCTCAGCCTCTCAAGT No data
Right 973294068 4:48496090-48496112 GCTGCACTAAAAGGTTTTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 142
973294057_973294068 30 Left 973294057 4:48496037-48496059 CCATCCTCCTGGCTCAGCCTCTC No data
Right 973294068 4:48496090-48496112 GCTGCACTAAAAGGTTTTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 142
973294063_973294068 13 Left 973294063 4:48496054-48496076 CCTCTCAAGTGGCTGGGACTACA 0: 38
1: 2873
2: 52611
3: 172227
4: 257423
Right 973294068 4:48496090-48496112 GCTGCACTAAAAGGTTTTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 142
973294060_973294068 23 Left 973294060 4:48496044-48496066 CCTGGCTCAGCCTCTCAAGTGGC 0: 2
1: 73
2: 5079
3: 94118
4: 205907
Right 973294068 4:48496090-48496112 GCTGCACTAAAAGGTTTTAAAGG 0: 1
1: 0
2: 0
3: 18
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973294068 Original CRISPR GCTGCACTAAAAGGTTTTAA AGG Intergenic
901587575 1:10310830-10310852 GGTGCTCTGAAAGGGTTTAACGG + Intronic
901660007 1:10793497-10793519 TATGCACTAAAACGTTTAAAGGG - Intronic
902066673 1:13694008-13694030 GTTACACTAAAAGTTTTGAAAGG + Intergenic
907252611 1:53151386-53151408 TCTTCAATAAAACGTTTTAAAGG + Intergenic
908514364 1:64876942-64876964 GCTTCTATAAAATGTTTTAATGG + Intronic
909474713 1:76069858-76069880 GCTGCCCTAAAAGATTAGAATGG - Intergenic
911468091 1:98280292-98280314 GCTGTATTAAAAGCTTTTAGGGG + Intergenic
913484963 1:119325995-119326017 GCTGCACTATATGGTCTAAAAGG + Intergenic
913592944 1:120346619-120346641 GCTCCATTAAAAGATTTTAAAGG + Intergenic
913650405 1:120908496-120908518 GCTCCATTAAAAGATTTTAAAGG - Intergenic
914170712 1:145220571-145220593 GCTCCATTAAAAGATTTTAAAGG + Intergenic
914525829 1:148464534-148464556 GCTCCATTAAAAGATTTTAAAGG + Intergenic
914597843 1:149171291-149171313 GCTCCATTAAAAGATTTTAAAGG - Intergenic
914640572 1:149602593-149602615 GCTCCATTAAAAGATTTTAAAGG - Intergenic
916728846 1:167548449-167548471 GCTTCACTGAAAGATTTAAAGGG + Intronic
921750984 1:218794198-218794220 GCTGCATTAAAAGGATTTCCAGG - Intergenic
924375086 1:243399331-243399353 CTTGCACTGAAGGGTTTTAATGG - Intronic
1063068808 10:2637948-2637970 GATGCAGGAAAAGGTTTGAAGGG + Intergenic
1069419471 10:68233968-68233990 GCTGCAGTAAAGGGTCTTAGAGG + Intergenic
1070222096 10:74458438-74458460 TCTGCACTAAAATGTTTCACTGG - Intronic
1072124195 10:92431056-92431078 TCTGCAGCAAAAGGATTTAATGG - Intergenic
1072176034 10:92922859-92922881 GCTGCCCTAGGAGTTTTTAAGGG + Intronic
1079014031 11:16853843-16853865 GCTGCAGAAGAAGATTTTAAGGG + Intronic
1079500758 11:21098743-21098765 GCTGATCTAAAAAGTTTTACTGG - Intronic
1080031733 11:27668552-27668574 GATGCAATAAAAGGTGATAAAGG + Intronic
1080137660 11:28875616-28875638 GATTCACCAAAATGTTTTAAAGG - Intergenic
1081279079 11:41186318-41186340 GTGGCACTAAAAGATTTTATTGG - Intronic
1083806025 11:65074571-65074593 ATTGTATTAAAAGGTTTTAAAGG + Intronic
1084638447 11:70409303-70409325 GCTGTATTAAAATTTTTTAATGG + Intronic
1088697023 11:112376063-112376085 GCTTCAAGAAAAGGTTTTTATGG - Intergenic
1090629657 11:128635087-128635109 TCTCCACTCAAATGTTTTAATGG - Intergenic
1091076857 11:132626784-132626806 GCTGTACAGAACGGTTTTAAAGG + Intronic
1091200154 11:133772525-133772547 ACAGCACTCAAAGGTTTTACTGG + Intergenic
1092823971 12:12379744-12379766 GCTGACATAAAAAGTTTTAATGG - Intronic
1093068448 12:14683753-14683775 GCTCCATCAAAAGGTTTTAGTGG + Intronic
1093183232 12:15990183-15990205 GCTACACCAAATGGTTTTGAAGG - Intronic
1094162277 12:27404341-27404363 GTTGCACTAAAATGTTTTAGTGG - Intronic
1097551319 12:61075418-61075440 TTTCCACTAAAATGTTTTAAAGG - Intergenic
1097984456 12:65768675-65768697 GCTTAACAAAATGGTTTTAAGGG + Intergenic
1103902340 12:124309866-124309888 GCTGCCTTAAAAGGCTTTAGGGG + Intronic
1106397273 13:29393383-29393405 GCTAAAGTAAAAGTTTTTAAAGG - Intronic
1106671787 13:31913840-31913862 GCTCCACTGAAAGTTTTTTAAGG + Intergenic
1107187276 13:37538406-37538428 TCAGCTCTAAAATGTTTTAATGG - Intergenic
1110108828 13:71716684-71716706 GCTGCATTTAAAGGTTTTGTTGG - Intronic
1110910627 13:80957618-80957640 TCTGAACTGAAATGTTTTAATGG + Intergenic
1115114560 14:29864301-29864323 CCTGCACTTAAAAGTCTTAAAGG + Intronic
1116451723 14:45074682-45074704 GCTAGACTAGAAGATTTTAAAGG + Intergenic
1119071538 14:71590202-71590224 GCTGCTCAAAAAGCTTGTAAGGG - Intronic
1120267630 14:82271657-82271679 GCGGCACTAGAAGGTCTTCAGGG - Intergenic
1120348017 14:83315079-83315101 GTTGCAATACAAGGTTTTTATGG - Intergenic
1120855401 14:89207679-89207701 TCTACAGTAAAAAGTTTTAATGG + Intronic
1121707704 14:96011317-96011339 GAAGGACTAAATGGTTTTAAGGG - Intergenic
1125437434 15:39661913-39661935 GCTGTATTAGAAGGTGTTAATGG - Intronic
1126147558 15:45490410-45490432 TCTTCCCTAAAAAGTTTTAAGGG + Intronic
1138831107 16:60375427-60375449 ACTTCACTAAAAGGATGTAAGGG - Intergenic
1142503889 17:350725-350747 TCTGCACTAAAAGGATGAAATGG + Intronic
1143848526 17:9791611-9791633 GTTGCACTAAAAGGCTGTCAGGG + Intronic
1144297084 17:13886330-13886352 ACTGAACTAAAAGCTTTCAAAGG + Intergenic
1146397227 17:32478378-32478400 GCTGTGCTACAAGGTGTTAAGGG - Intronic
1148164588 17:45474354-45474376 GCTGCAAAAAAATGTTTAAAAGG + Intronic
1150395807 17:64821017-64821039 GCTGCAAAAAAATGTTTAAAAGG + Intergenic
1153075718 18:1159773-1159795 GCTGCCCTAAAAGACTTCAAGGG + Intergenic
1159183953 18:64945791-64945813 GTTGCTTTTAAAGGTTTTAACGG - Intergenic
1159993113 18:74933978-74934000 GCTGCAGTAAAAGCTATTAGGGG - Intronic
1165131909 19:33637963-33637985 GCTGCCCTAAAAGGAAATAAAGG + Intronic
1168034952 19:53711892-53711914 CATGGACTAAAAGGTGTTAATGG - Intergenic
932981659 2:76676121-76676143 GCAGCAGCAAAATGTTTTAAGGG - Intergenic
933751150 2:85602682-85602704 GCAGCCCTGAAAGGTTTAAAGGG + Intronic
939328167 2:140722510-140722532 ACTGTACTAAGAGGTATTAATGG - Intronic
940495802 2:154426674-154426696 TCTGCCCTGAAGGGTTTTAAAGG - Intronic
941591456 2:167425458-167425480 TCTCAACTAACAGGTTTTAAAGG + Intergenic
941801138 2:169661096-169661118 GCAGCATTAAAAGGTCTTCAGGG - Intronic
942321845 2:174742812-174742834 GCTGGACTTTAAAGTTTTAATGG - Intergenic
942336220 2:174889171-174889193 TCTCCCCTAAAAGGTTTTAGAGG + Intronic
943390090 2:187255537-187255559 GTTTCACTAGAAGGTTTTCAGGG - Intergenic
943656565 2:190514943-190514965 GCTGGACTAAAATGTTATCATGG + Intronic
944773232 2:202934748-202934770 CCTGGCCTAAAAGTTTTTAAAGG + Intronic
946090101 2:217214613-217214635 GCTTCAGTAAAAGCTTTTACCGG + Intergenic
1169158554 20:3355993-3356015 ACTACATTAAAACGTTTTAAGGG + Intronic
1174137612 20:48391382-48391404 ACTGCACAAAAATATTTTAAAGG - Intergenic
1176892082 21:14330458-14330480 GATGCAATAAAAAGTGTTAAAGG + Intergenic
1178105198 21:29310776-29310798 GCTTCACTAAATGGTTTCCACGG + Intronic
1179730542 21:43364992-43365014 GCCGCCGTAAAAGGTTGTAATGG - Intergenic
1185034757 22:48467637-48467659 GCTGCAAAAAAAGGTTTTACAGG - Intergenic
950837245 3:15932462-15932484 TGTGCACTACAAGGTTTTGAGGG - Intergenic
951684074 3:25325170-25325192 GCTACACTATATGGTTTAAAAGG - Intronic
955976208 3:64482718-64482740 GCTGCGCCAAAAGATTTTAAAGG - Intergenic
956913501 3:73846231-73846253 AGTACACCAAAAGGTTTTAAAGG + Intergenic
958841776 3:99213947-99213969 GCAGCACAAAAATATTTTAATGG + Intergenic
960149561 3:114237014-114237036 TCTGCACTCACAGGTTTTACAGG - Exonic
962700541 3:137995013-137995035 GCTGACCTTAAAGGTTTTAAAGG + Intergenic
966192263 3:177281887-177281909 ACTGCTCTAAATGATTTTAAAGG + Intergenic
967361975 3:188641652-188641674 GCTGCACAAAATTATTTTAATGG - Intronic
967417277 3:189233070-189233092 GCTGGGCTAAGAGGTTTGAAGGG + Intronic
970137505 4:12941714-12941736 GCTTCAGTATAAGGTTTTGAGGG - Intergenic
973088074 4:46093833-46093855 ACTGGACTAAAAATTTTTAAAGG + Intronic
973294068 4:48496090-48496112 GCTGCACTAAAAGGTTTTAAAGG + Intergenic
976772569 4:88669693-88669715 TCTCCCCAAAAAGGTTTTAATGG + Intronic
977294641 4:95197524-95197546 GCTGAAGTAAAAGGTTTGGAGGG + Intronic
980195027 4:129577769-129577791 CCTGCAATAAATGGATTTAACGG - Intergenic
980608501 4:135124959-135124981 TCTGCACTAATAAGTTGTAATGG + Intergenic
982095549 4:151918767-151918789 GCTTAACCTAAAGGTTTTAATGG + Intergenic
982097997 4:151940951-151940973 GCTGACATTAAAGGTTTTAATGG + Intergenic
984444560 4:179818673-179818695 GCTGCACTAAAAGTTTGTTCAGG + Intergenic
984609569 4:181822412-181822434 GCTGTATTATAAGCTTTTAAAGG + Intergenic
984942585 4:184946730-184946752 CCTGCTTTAAAAGGATTTAAGGG - Intergenic
984949031 4:184993066-184993088 ACTGCAGAAAAAGGATTTAAAGG - Intergenic
986156980 5:5185910-5185932 TCTGCATCACAAGGTTTTAAAGG + Intronic
988961781 5:36378230-36378252 GCTGCAGGAAAATGTGTTAAAGG - Intergenic
989611753 5:43300486-43300508 TCTGCAATTAAAGGTCTTAAGGG + Intronic
989811453 5:45681670-45681692 CCTGTACAATAAGGTTTTAAAGG + Intronic
989981512 5:50651033-50651055 GCTCCATTAAAAGATTTTAAAGG - Intergenic
993680028 5:90865752-90865774 CCTTAGCTAAAAGGTTTTAAGGG - Intronic
999384159 5:151142541-151142563 GCTGAACTAAAAGGTCTTTAAGG - Intronic
1000415088 5:160976000-160976022 ACTGCACTCAAAGGTCATAAAGG - Intergenic
1000490334 5:161904886-161904908 GATGCAATAAAAAATTTTAAAGG - Intergenic
1001241760 5:170076677-170076699 GCTGGACCAGATGGTTTTAAAGG - Intronic
1003866745 6:10370330-10370352 GCCGCACTGGAAGGTTTTCAGGG - Intergenic
1006977734 6:38119308-38119330 ACTGCCCTGAAAGGTTTTAGAGG + Intronic
1007818747 6:44544149-44544171 GCTTCATTAAATGTTTTTAAAGG - Intergenic
1007877620 6:45123823-45123845 GCTGCACTAAAACTTATGAATGG + Intronic
1009497122 6:64364567-64364589 GCTGCAGTAACATGTTTTAAAGG + Intronic
1010373327 6:75137150-75137172 CCAGCACTAATAGTTTTTAAAGG + Intronic
1012026626 6:94002107-94002129 GCAGGAATAAAATGTTTTAAAGG + Intergenic
1012137968 6:95582486-95582508 GTTGCACTAACAGGTATAAAAGG - Intronic
1012591303 6:100984787-100984809 TTTGCATTAAAAAGTTTTAAAGG + Intergenic
1013230706 6:108159127-108159149 GATGCACAAACAGTTTTTAAAGG - Intronic
1016306964 6:142694837-142694859 GCTGCACTAAAATGTGTTCTTGG - Intergenic
1017894928 6:158671281-158671303 GGTTCTCAAAAAGGTTTTAAAGG - Intronic
1018894980 6:168008144-168008166 GCTTCAGGAAAAGGTTTTATGGG - Intronic
1021367906 7:19804280-19804302 GCAGAACTAGCAGGTTTTAAAGG - Intergenic
1021899765 7:25273271-25273293 GCTTCAATAAAAGGTTTTTTGGG - Intergenic
1023582488 7:41697617-41697639 GCTGCACAAAATGGTTATAAGGG + Intronic
1024354213 7:48397566-48397588 TCTCCACTAAAAGATTTTCAGGG - Intronic
1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG + Intergenic
1025659872 7:63551240-63551262 CCGGCCCTAAATGGTTTTAAGGG - Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1032725105 7:134583858-134583880 GCAACACTATAAGATTTTAAGGG - Intergenic
1037602235 8:20406824-20406846 GCTGCAATAAAGGATTTCAATGG - Intergenic
1041741075 8:61157269-61157291 GATGCACTAAAACGATTTACAGG + Intronic
1042411467 8:68471173-68471195 GCTTCACTTAATGGTTTTAAGGG + Intronic
1044326085 8:90859913-90859935 GCTGCACCAAAATGTTTACAGGG + Intronic
1045646132 8:104301093-104301115 GCTTTACTAAAAGGTATTAAAGG + Intergenic
1048070972 8:131020684-131020706 GCTGGACTAAACTATTTTAAAGG - Intronic
1048237491 8:132705746-132705768 GCTGCTCTAAAAAGTATAAATGG - Intronic
1051822807 9:21187761-21187783 CCTGCACTCAAAGGCTTTTATGG + Intergenic
1052620055 9:30896814-30896836 GCTGCACTAATAGGTTCTTTAGG + Intergenic
1058031507 9:100203463-100203485 GCTGCAGTAAATGTTTTTCAAGG - Intronic
1061105932 9:128530514-128530536 GCTGGACTACAAGATCTTAAAGG - Intronic
1061967278 9:134022653-134022675 GCTGCACAAAAGGTTTTTAAGGG - Intergenic
1188846674 X:35080197-35080219 ATTGCACAAAAAGCTTTTAAAGG - Intergenic
1189124332 X:38430059-38430081 ATTGCAGTGAAAGGTTTTAAAGG - Intronic
1189786448 X:44562888-44562910 GCTGAACTAAAAGGTTTATAAGG + Intergenic
1190849751 X:54227037-54227059 GAAGCACAAAAAGTTTTTAATGG - Intronic
1194143382 X:90233414-90233436 GCAGGACTAAAAGTTTTTCATGG + Intergenic
1194747337 X:97642377-97642399 GCTGTGCTAAAAGCTTTAAAAGG + Intergenic
1197230656 X:124000187-124000209 ACTGCACTAAGACGTTATAAAGG - Intronic
1197561682 X:128030988-128031010 GCTGCTTTTACAGGTTTTAATGG - Intergenic
1200489133 Y:3802736-3802758 GCAGGACTAAAAGTTTTTCATGG + Intergenic
1200943848 Y:8811770-8811792 GCTGCAATGAAAGATTATAAGGG + Intergenic
1202603573 Y:26619041-26619063 GCTGCAATAAATTTTTTTAATGG - Intergenic