ID: 973296586

View in Genome Browser
Species Human (GRCh38)
Location 4:48529774-48529796
Sequence GGCACCAAGGCACCAAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973296576_973296586 23 Left 973296576 4:48529728-48529750 CCTTCTTGAAAAGTTCCTCCCTT 0: 1
1: 0
2: 1
3: 30
4: 272
Right 973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 166
973296580_973296586 4 Left 973296580 4:48529747-48529769 CCTTGGCTTCCGAAAGACCACTT 0: 1
1: 0
2: 0
3: 15
4: 149
Right 973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 166
973296578_973296586 8 Left 973296578 4:48529743-48529765 CCTCCCTTGGCTTCCGAAAGACC 0: 1
1: 0
2: 8
3: 300
4: 9769
Right 973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 166
973296579_973296586 5 Left 973296579 4:48529746-48529768 CCCTTGGCTTCCGAAAGACCACT 0: 1
1: 0
2: 2
3: 6
4: 108
Right 973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 166
973296582_973296586 -5 Left 973296582 4:48529756-48529778 CCGAAAGACCACTTCAATGGCAC 0: 1
1: 0
2: 0
3: 6
4: 95
Right 973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG 0: 1
1: 0
2: 2
3: 14
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973296586 Original CRISPR GGCACCAAGGCACCAAGAGT GGG Intronic
900405032 1:2489180-2489202 GGCCCCAAGGCAGAAAGAGCAGG - Intronic
902817994 1:18926973-18926995 GACACCAGGGCAGCAAGAGACGG + Intronic
903038578 1:20511314-20511336 GGTACAAAGCTACCAAGAGTTGG + Intergenic
904429472 1:30452756-30452778 GGAATCCAGGCACCCAGAGTCGG - Intergenic
904888170 1:33757543-33757565 GGCATAAAGGAAGCAAGAGTGGG - Intronic
905393046 1:37650505-37650527 GGCCCCAAGGCACCAGCAGTGGG + Intergenic
906561052 1:46757240-46757262 GGCACCAAGGGACCAGAAGGCGG + Intergenic
907266761 1:53266432-53266454 TGCAGCAAGGCATGAAGAGTGGG - Intronic
908705305 1:66947542-66947564 GGCAGCAATGGATCAAGAGTCGG - Intronic
908930811 1:69314745-69314767 AGTACTGAGGCACCAAGAGTGGG + Intergenic
912244124 1:107943132-107943154 GCCACCAAGACTCTAAGAGTAGG - Intronic
915557420 1:156668403-156668425 GGCACCAAGGCACTAATGGGGGG + Intergenic
921628288 1:217402652-217402674 GGCAGCAAGGTACCAGGATTAGG - Intergenic
923579653 1:235196265-235196287 GCTACCAAGGCACAAAGAGAGGG + Intronic
924464303 1:244286161-244286183 GGCACCTAGGTGCCAAGAGGTGG - Intergenic
1064952712 10:20872181-20872203 GGCACAAAGGCAGCAGGAGCAGG + Intronic
1066271045 10:33823812-33823834 AGCATCATGGAACCAAGAGTCGG - Intergenic
1067479953 10:46588165-46588187 CGCACTCAGGCACCAAGTGTCGG + Intronic
1067614784 10:47753632-47753654 CGCACTCAGGCACCAAGTGTCGG - Intergenic
1067692550 10:48511233-48511255 GCCACGAAGGCACCGAGAGCAGG - Intronic
1070539376 10:77405356-77405378 GGCACCAAGGCTGCAGCAGTGGG - Intronic
1071579333 10:86756035-86756057 GGCACCAAGTCACCAAGGTGGGG - Intergenic
1077103486 11:832346-832368 TGCACCAAGACGCCAAGAGTGGG - Intergenic
1077579624 11:3408451-3408473 TGCTCCAGGGCACCAAGTGTGGG + Intergenic
1077633680 11:3827503-3827525 GGCACCAAGGCACAACTGGTGGG + Exonic
1079372496 11:19863436-19863458 GTTAGCCAGGCACCAAGAGTGGG - Intronic
1079977537 11:27110437-27110459 GCCACCAGGGGATCAAGAGTGGG - Intronic
1083633105 11:64105779-64105801 GGCGCCAAGGCCCCAGGAGGTGG + Intronic
1083952174 11:65962778-65962800 TGCACCAAGGCAGCAGCAGTGGG + Intronic
1084455351 11:69265059-69265081 GGCCCCAAGGCACCCAGTGCCGG - Intergenic
1084673465 11:70621095-70621117 GGCACCAAGGCACCGGGATCGGG + Intronic
1085467468 11:76734067-76734089 GGCACCAAGGCTCCAATAATTGG + Intergenic
1085627618 11:78085396-78085418 GGTACCAGGGGACTAAGAGTAGG - Intergenic
1088338243 11:108732702-108732724 GGCACAAAGGCAGTAAGAGATGG + Intronic
1088419469 11:109626863-109626885 TGCACCAAGGAACAAAGATTAGG + Intergenic
1088903225 11:114134282-114134304 GGCAGCAATGCAACCAGAGTTGG - Intronic
1088926751 11:114310758-114310780 GGCCCCAGAGCACTAAGAGTAGG - Intronic
1089632402 11:119791900-119791922 GGCACCGAGGCCCCAGGACTAGG + Intergenic
1090931275 11:131300068-131300090 GGCCCAAGGGCACCAAGAGGAGG + Intergenic
1092407544 12:8231403-8231425 TGCTCCAGGGCACCAAGTGTGGG + Intergenic
1095235904 12:39795523-39795545 GGGAACTAGGCACCATGAGTAGG - Intronic
1097003914 12:55901510-55901532 GGAACCAAGACTCCAAGACTTGG + Exonic
1097038987 12:56143082-56143104 AGAACCGAGGCACCAAGAGGAGG + Exonic
1100999873 12:100346717-100346739 GGCACAAAGGTCTCAAGAGTGGG - Intergenic
1103669859 12:122604703-122604725 GGCACCAGGGCAGCATGAGAAGG - Intronic
1106099539 13:26682561-26682583 GTCACCAAGGGAACAAGAGAGGG - Intronic
1108041237 13:46340961-46340983 AGCACCAAGTCACCATGGGTAGG + Intergenic
1112583523 13:100696710-100696732 GGCAAGAAGACACCAAGAGGTGG - Intergenic
1114599669 14:23944195-23944217 GGCACCACGGGACCAAAAGGCGG - Intergenic
1120095883 14:80387122-80387144 GGCACCAGGGATCCAATAGTGGG + Intronic
1120651644 14:87140989-87141011 GGAACCAAGACTCCAAGACTCGG + Intergenic
1122795269 14:104202988-104203010 GGCACAAAGGGGCCAAGGGTGGG - Intergenic
1123206546 14:106719221-106719243 AGCATCAAGGCACCAAAAATAGG - Intergenic
1126341197 15:47642767-47642789 GGCAGGAAGGCAGCAGGAGTTGG + Intronic
1127142492 15:55992415-55992437 GACACCAAGGTACTAAGAGAAGG + Intronic
1127982222 15:64043799-64043821 GGCTCCAAGTCACAAAGAGGAGG - Intronic
1129178567 15:73857192-73857214 GTCACCAAGGCCTGAAGAGTTGG + Intergenic
1129772490 15:78211710-78211732 GACACCAATCCACCAAGAGATGG - Intronic
1132399420 15:101496390-101496412 GGGACCAGGGCACCAAGGGAGGG - Intronic
1132903278 16:2269745-2269767 GGCAGGAAGTCACCAAGAGCTGG - Intergenic
1133348245 16:5084515-5084537 TGCTCCAGGGCACCAAGTGTGGG + Exonic
1135669167 16:24360456-24360478 AGCACCAGGGCACCAGGACTTGG - Intronic
1136558813 16:31026078-31026100 GGCAGCAAGTCCCCAAGGGTAGG + Intergenic
1137491584 16:48937549-48937571 GGCAGCATGGCACCAGGTGTGGG + Intergenic
1138573006 16:57887863-57887885 GGCTGCAAAGCAGCAAGAGTTGG - Exonic
1138580748 16:57939257-57939279 GGCCCCAAGACACCAAGGATGGG + Intronic
1141710590 16:85696728-85696750 GCAGCCAAGGCACCAAGAGTGGG + Intronic
1141846083 16:86609973-86609995 GTCACCAAGGCACCAATCCTGGG - Intergenic
1144646315 17:16976378-16976400 GGCCTCAAGGGACCAGGAGTAGG - Intergenic
1146373301 17:32278687-32278709 GAAACCAAGGCACCAAGAGCTGG - Intronic
1148208001 17:45791623-45791645 GGCACCCAGGCACCAGGATAGGG - Intronic
1150651694 17:67014571-67014593 TGCCTCCAGGCACCAAGAGTTGG + Intronic
1155556867 18:27029441-27029463 GGAACCAAGGAACCAAGGGTGGG + Intronic
1156672558 18:39488342-39488364 GGCATAAAGGCTACAAGAGTAGG - Intergenic
1160987473 19:1845838-1845860 GGCACCAAGGCAGGCAGGGTTGG - Intronic
1161355009 19:3814063-3814085 GGCACCCAGGCAGCAAGTGTGGG - Intronic
1165488185 19:36108053-36108075 GGCCACAAGGCACAAAGAGAAGG + Intergenic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
1166747688 19:45149405-45149427 GCCAGCAATGCACCAGGAGTGGG + Intronic
1167665796 19:50822245-50822267 GGGATCAAGGCGCCAAGGGTGGG + Intronic
1168241952 19:55092908-55092930 GGGACCCAGGCACCGAGAGGGGG - Intronic
1168351652 19:55679548-55679570 TGCACCAAGACACCCAGAGCGGG - Intronic
925078639 2:1041549-1041571 AGCACCAAGCCACGAAGAATCGG - Intronic
925301740 2:2820249-2820271 GGCAACATGGCACCCAGAGGTGG + Intergenic
925608501 2:5683546-5683568 CACACCAAGTCCCCAAGAGTTGG - Intergenic
927519012 2:23688167-23688189 GTCACCAAGTTACCAAGGGTGGG + Intronic
928083215 2:28328025-28328047 CTCACCAAGGCACCCAGAATTGG + Intronic
929533721 2:42767753-42767775 GGCCCCAAGGCCCCAAGAGTGGG + Intronic
930703160 2:54479627-54479649 GAAACCAAGACACCAAGATTAGG - Intronic
931836783 2:66107636-66107658 GACACCAAGGCACCCAGCCTAGG - Intergenic
933476421 2:82797665-82797687 GGCACCTTGGCACCAACAATAGG + Intergenic
934681932 2:96290262-96290284 GACACCAAGGCACCAGGAGTGGG - Intronic
935327190 2:101947806-101947828 AGCACCAGGGCACCATGAGTGGG + Intergenic
938297620 2:130188256-130188278 GGCACCTAAGCACCCAGATTAGG + Intronic
938459150 2:131486408-131486430 GGCACCTAAGCACCCAGATTAGG - Intronic
941721789 2:168820261-168820283 AACACCAAGGCACAGAGAGTTGG - Intronic
942931586 2:181500561-181500583 GGTACCATGGTACCAGGAGTGGG + Intronic
946172468 2:217903744-217903766 AGGACCAAGGCAAAAAGAGTTGG - Intronic
947856256 2:233326613-233326635 GGCAGCAAGGCACCCAGTGCGGG - Intronic
947872340 2:233446356-233446378 GGCCCCAAGGCACACAGAGGAGG - Intronic
1169250941 20:4060832-4060854 GGTAACAAGGCACCCAGGGTTGG + Intergenic
1172134723 20:32679290-32679312 GGCCCCCAGGCAGTAAGAGTAGG + Intergenic
1173864103 20:46303239-46303261 GGTACCAAGGCCCCAAGGGGAGG - Intronic
1176059033 20:63164136-63164158 GGCACCAAGGGACCCACTGTGGG - Intergenic
1176408587 21:6435343-6435365 GACACCACAGCACCAAGAGATGG - Intergenic
1176680996 21:9819197-9819219 GGCACAAACCCACAAAGAGTGGG + Intergenic
1176684934 21:9838903-9838925 GGCACAAACCCACAAAGAGTGGG + Intergenic
1177235191 21:18380127-18380149 ATCACCAAGGCACCATGATTTGG + Intronic
1179628677 21:42663633-42663655 GGCACCCCGCCCCCAAGAGTCGG - Intronic
1180245418 21:46544182-46544204 GGCAGCAGGTCACCGAGAGTTGG + Intronic
1181510473 22:23386621-23386643 GGCTCCAAGGCCCCAGGAGGTGG - Intergenic
1182502206 22:30755829-30755851 GGCACCAAGACACCAGGATTTGG - Intronic
1183034791 22:35133542-35133564 GGCACCGAGACACCAAGGCTAGG + Intergenic
952363647 3:32655167-32655189 GGCAGCAATGCAGCAAGAGTAGG - Intergenic
953385130 3:42502007-42502029 AACACCAAGGAACCCAGAGTCGG + Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954371637 3:50172086-50172108 GGCCCCAAGGCACCTGGAGGGGG - Intronic
957052591 3:75421777-75421799 TGCTCCAGGGCACCAAGTGTGGG + Intergenic
958838136 3:99171134-99171156 GGAATCAAGGCTCCAAGAGTTGG - Intergenic
961302249 3:125929780-125929802 TGCTCCAGGGCACCAAGTGTGGG - Intronic
961368244 3:126414773-126414795 GTGCCCAAGGCAGCAAGAGTGGG - Intronic
961483169 3:127196959-127196981 GGCACCAAGGCAGCTGGAGGGGG - Exonic
961486622 3:127221632-127221654 GGCACCAAAGCAGCTGGAGTGGG + Intergenic
961775251 3:129279367-129279389 GGCACCAAGTCACCCGGAGGAGG + Intronic
961886205 3:130098001-130098023 TGCTCCAGGGCACCAAGTGTGGG + Intronic
962165548 3:133044026-133044048 GTCACCATGGCACCAAAAGTAGG - Intronic
962520607 3:136195286-136195308 GGCGCCAAGGCCCCATGTGTGGG - Exonic
962608781 3:137055341-137055363 GGCACCTAAACTCCAAGAGTGGG - Intergenic
967923851 3:194631731-194631753 GGCACCCTGGCCCCAAGAGCTGG - Intronic
969818562 4:9704104-9704126 TGCTCCAGGGCACCAAGTGTGGG - Intergenic
972381559 4:38524720-38524742 GGCACAAAGTCAACCAGAGTTGG + Intergenic
973296586 4:48529774-48529796 GGCACCAAGGCACCAAGAGTGGG + Intronic
975984170 4:80187843-80187865 GGCAACCTGGCACCAAGAGATGG + Intronic
989482310 5:41946129-41946151 GGCACCATGGGACCAAAAGGTGG + Intergenic
993336706 5:86668623-86668645 GGCACCAAGGCAACATGTATTGG - Intergenic
995342038 5:111071035-111071057 TGCCCCTAGCCACCAAGAGTAGG + Intronic
996607007 5:125335031-125335053 AGCACCAAAGCACCAGGAGATGG + Intergenic
997232232 5:132253485-132253507 GGCACAAAGGCACCAACACAGGG + Intronic
997400703 5:133599720-133599742 GACACCCAGGCCCCAAAAGTGGG + Intronic
997400750 5:133599865-133599887 AGCACCCAGGCCCCAAAAGTGGG + Intronic
997706843 5:135963466-135963488 GGAACCAAGGCACCAAAGATGGG - Intergenic
1000672853 5:164083925-164083947 GGAATCAAGGCACAAAGAGAAGG - Intergenic
1003556528 6:7144802-7144824 GATACCAAGGCACATAGAGTTGG - Intronic
1006787564 6:36678777-36678799 GGCACCGAGGCACTCAGAGGAGG + Exonic
1007618317 6:43195762-43195784 AGCACCAAGGCTACCAGAGTGGG - Intronic
1013432242 6:110065406-110065428 GTCACCAAGGCAGCAAGGCTAGG + Intergenic
1018043769 6:159948138-159948160 GGCACCAAGGCCCTAATTGTTGG - Intergenic
1019135010 6:169902511-169902533 GGTCCCAAGGCACCAAGACCGGG + Intergenic
1019364100 7:622668-622690 GGCACATATGCACCAACAGTAGG + Intronic
1020154153 7:5708761-5708783 AGCTCCAAGGCATCTAGAGTAGG + Intronic
1020540142 7:9452300-9452322 GGAATCAAGGCAAAAAGAGTTGG - Intergenic
1023347428 7:39285832-39285854 GGGAGGAAGGCACCAGGAGTGGG - Intronic
1025641050 7:63369654-63369676 GGCACCATGCCAGCCAGAGTTGG + Intergenic
1025854540 7:65265975-65265997 TGCACAAAGGCAGCAAGAGAAGG - Intergenic
1029712469 7:102307231-102307253 GGCACAAAGGCATCAAGGGGGGG + Intronic
1035155553 7:156909231-156909253 GGCTCCAAGGCCCCAGGAGCAGG - Intergenic
1036847922 8:12182321-12182343 TGCTCCAGGGCACCAAGTGTGGG + Intronic
1036869290 8:12424636-12424658 TGCTCCAGGGCACCAAGTGTGGG + Intergenic
1042916397 8:73879261-73879283 GGCCCCAAGGCTCTGAGAGTGGG - Intergenic
1044995639 8:97835694-97835716 GGCTCCAAGGCACCACCAGCAGG - Intronic
1045343324 8:101273119-101273141 GGCACCATGGCATCAAGTGGAGG - Intergenic
1047548076 8:125839168-125839190 AACACCAAGTCACTAAGAGTGGG - Intergenic
1048248042 8:132830892-132830914 AGCAACAAGGCAACAAAAGTGGG - Intronic
1049599606 8:143501158-143501180 AACACCAGGGCACCCAGAGTTGG + Intronic
1054664615 9:67723731-67723753 GGCACAAACGCACAGAGAGTGGG + Intergenic
1056212678 9:84379809-84379831 GTGACAAAGGCAGCAAGAGTTGG - Intergenic
1057212609 9:93208940-93208962 GTCACCAAGGCACCATCAGAGGG - Intronic
1058497024 9:105569520-105569542 GGCAGCTAGACCCCAAGAGTAGG - Intronic
1059643458 9:116239899-116239921 GACACCAAGACATCAAGGGTGGG - Intronic
1060545736 9:124458074-124458096 GGCACCAAGGCACCACCCGGTGG - Intronic
1062402864 9:136380071-136380093 GGCACAGAGCCACCCAGAGTGGG + Intronic
1062403324 9:136381960-136381982 GGCACAGAGCCACCCAGAGTGGG - Exonic
1203664742 Un_KI270754v1:14692-14714 GGCACAAACCCACAAAGAGTGGG + Intergenic
1203666452 Un_KI270754v1:23144-23166 GGCACAAACCCACAAAGAGTGGG + Intergenic
1203667601 Un_KI270754v1:28783-28805 GGCACAAACCCACAAAGAGTGGG + Intergenic
1203668750 Un_KI270754v1:34422-34444 GGCACAAACCCACAAAGAGTGGG + Intergenic
1203669026 Un_KI270754v1:35832-35854 GGCACAAACCCACAAAGAGTGGG + Intergenic
1186515719 X:10165012-10165034 GGCAACAAGGGAACAAGTGTGGG - Intronic
1187925958 X:24250303-24250325 GAGAACAAGGCACCAGGAGTGGG - Intergenic
1189555580 X:42142014-42142036 GGGATCAAGGCAGCCAGAGTGGG - Intergenic
1195923468 X:110003633-110003655 GACACCAGGGCACCGAGAGTAGG - Exonic
1198379113 X:136067644-136067666 GGCACCAAGACACAAAGACTGGG - Intergenic
1198736843 X:139795173-139795195 GATACCAAGGCACTAAGAATAGG - Intronic