ID: 973305099

View in Genome Browser
Species Human (GRCh38)
Location 4:48638786-48638808
Sequence ATGTGTTCATGTCCTTTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37746
Summary {0: 1, 1: 117, 2: 5701, 3: 22242, 4: 9685}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973305094_973305099 6 Left 973305094 4:48638757-48638779 CCATGGAATACTATGCAGCCATA 0: 24516
1: 14054
2: 8260
3: 5392
4: 3574
Right 973305099 4:48638786-48638808 ATGTGTTCATGTCCTTTGCGGGG 0: 1
1: 117
2: 5701
3: 22242
4: 9685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973305099 Original CRISPR ATGTGTTCATGTCCTTTGCG GGG Intronic
Too many off-targets to display for this crispr