ID: 973312654

View in Genome Browser
Species Human (GRCh38)
Location 4:48726273-48726295
Sequence CATTATGCCCAGAAGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973312654 Original CRISPR CATTATGCCCAGAAGGAGAA GGG (reversed) Intronic
900165765 1:1243753-1243775 CTTTATGCCCAGACGGAGCGTGG - Intronic
903098357 1:21002784-21002806 CATTCTGTCCAGAGGGATAAGGG + Exonic
904997292 1:34640932-34640954 TATTAATCCAAGAAGGAGAACGG + Intergenic
905474494 1:38216545-38216567 CATTCTGCCCTGAAGGAGAGCGG + Intergenic
906418688 1:45643953-45643975 CACTGTGCCCAGCAGGAAAATGG + Intronic
907826470 1:58021890-58021912 CATTGTGTTCAGAAGCAGAAGGG + Intronic
910359652 1:86403089-86403111 CATTATTACCAGCAGGACAAAGG + Intergenic
910519691 1:88105824-88105846 CCTCCTGCCCAGAAGGAAAATGG + Intergenic
910621088 1:89255548-89255570 CATAATGATCAGATGGAGAAGGG - Intergenic
911527185 1:99002161-99002183 CACTATTCCTAGAAGCAGAAGGG + Intronic
911794026 1:102054187-102054209 CATTATGCCCAGGAAGAAGATGG + Intergenic
912595737 1:110874132-110874154 GATTATGCCCTGGAGCAGAAAGG + Intronic
912702191 1:111886741-111886763 CATTTTAACCAAAAGGAGAAAGG + Intronic
912785480 1:112599459-112599481 CGTTTTACCCAGAAGTAGAATGG - Intronic
915929215 1:160048378-160048400 CAGTTGGCCCAGAAGGAGCAGGG - Intronic
917253825 1:173092733-173092755 CATTTTGCGCAAAAGGAGATTGG + Intergenic
917392857 1:174558038-174558060 CCTTATCCCCTGAAGGGGAATGG + Intronic
919364676 1:196642506-196642528 CATTATGCTCAGAAAAAGGATGG - Intergenic
920503970 1:206503630-206503652 CCTTGTGCTCAGAAGGGGAAAGG - Intergenic
922325405 1:224523893-224523915 CATTAAGCTGAGAAGGAGGATGG + Intronic
923651723 1:235880023-235880045 CACCATGCCCAGACTGAGAATGG + Intronic
1063475371 10:6323891-6323913 GTATATGCCCAGAAGTAGAATGG - Intergenic
1064727118 10:18291541-18291563 CTTAATGCCCAGAAGGAAGATGG + Intronic
1066688462 10:38003295-38003317 GACTTAGCCCAGAAGGAGAATGG - Intergenic
1067004169 10:42645685-42645707 GACTTAGCCCAGAAGGAGAACGG + Intergenic
1067176514 10:43953614-43953636 GATTCTGCCCAAAAGGAGAAGGG - Intergenic
1068842315 10:61629528-61629550 CATTGTGCCTTGAAGGGGAAAGG - Intergenic
1069247394 10:66223244-66223266 AATAATGCCAAGCAGGAGAAAGG + Intronic
1070378052 10:75853638-75853660 CATTATGTCATGAAGTAGAAAGG + Intronic
1070393572 10:75992123-75992145 CATTATGCACATGAGGAAAAAGG + Intronic
1070444504 10:76482904-76482926 CATTATGCCAAAAATGAGCAAGG - Intronic
1072937665 10:99729171-99729193 CACCATGCCCAGCTGGAGAAAGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1077555664 11:3224907-3224929 CATGATGCCCAGCTGGAGAGAGG - Intergenic
1080690402 11:34552565-34552587 CATCCTGCACAGAAGCAGAAAGG + Intergenic
1081193502 11:40133242-40133264 CAATATACCCAGAAGGTGTATGG + Intronic
1081440171 11:43072160-43072182 CAAGATACTCAGAAGGAGAAAGG + Intergenic
1082817241 11:57517176-57517198 CATTCCTCCCAGAAGGAGAATGG + Intergenic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1089518335 11:119047839-119047861 CATTAGCCCCAGAGGGAGAGGGG + Intronic
1090093164 11:123717508-123717530 CACTAAGCCCAGGAGGAGAATGG + Intergenic
1090966376 11:131600952-131600974 CATTTTGCCAAGAAGCAGATGGG - Intronic
1091024510 11:132130113-132130135 AAATATTCTCAGAAGGAGAAGGG + Intronic
1091517700 12:1201154-1201176 CATTGTGACAAAAAGGAGAAAGG - Intronic
1092298322 12:7220453-7220475 CATTTTACCTGGAAGGAGAAAGG + Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096596350 12:52698254-52698276 CATTTTGACCACAAAGAGAAAGG - Intronic
1096874487 12:54616560-54616582 CAATCTGTCCACAAGGAGAAAGG + Intergenic
1096907976 12:54953322-54953344 CCTTATGCCTAGTGGGAGAAAGG - Intronic
1098877826 12:75884929-75884951 CATTATACACACAAGAAGAAAGG + Intergenic
1099272996 12:80536635-80536657 CCTTAAGAGCAGAAGGAGAAAGG + Intronic
1104772910 12:131375446-131375468 CACTGTGCCCAGAAGGAAGATGG - Intergenic
1106625951 13:31421165-31421187 CAACATTCCCAGAAGAAGAATGG - Intergenic
1110603088 13:77399099-77399121 CTTTATGCCCAGAGAGAAAAAGG - Intergenic
1110867267 13:80409241-80409263 CATTATAGCCACTAGGAGAAAGG - Intergenic
1111181486 13:84672791-84672813 CATTATGCCAAGAAGGTGGGAGG + Intergenic
1111207937 13:85036275-85036297 AATCATGTCCAGAAGGTGAAGGG - Intergenic
1113797009 13:113064290-113064312 CATTATGACCTGGAGGAGAAAGG - Exonic
1114181216 14:20369503-20369525 AATGCAGCCCAGAAGGAGAATGG - Exonic
1115081322 14:29454451-29454473 CATTGTCCCCAAAAGGATAAAGG + Intergenic
1115417677 14:33155334-33155356 AATAATGCCCACAAGAAGAATGG - Intronic
1117533079 14:56677532-56677554 CAGTCTGTCCAGGAGGAGAAAGG - Intronic
1119194413 14:72706404-72706426 CAATATGCTTGGAAGGAGAAAGG - Intronic
1122666333 14:103333316-103333338 CGTGATGCCCACTAGGAGAAAGG + Intergenic
1127623851 15:60761009-60761031 CCCTGTGCCCAAAAGGAGAAGGG - Intronic
1128759610 15:70207118-70207140 CCAATTGCCCAGAAGGAGAATGG - Intergenic
1128907595 15:71482034-71482056 GACTATGGCCAGAAGGAGCAGGG - Intronic
1129662282 15:77559807-77559829 CATAATATCCAGAAGGAGAGAGG + Intergenic
1129771325 15:78205110-78205132 CTTGAAGCCCAGCAGGAGAAGGG - Intronic
1130085759 15:80777718-80777740 CATTTGGCCCAAATGGAGAAAGG - Intergenic
1130547272 15:84866074-84866096 CATTATTCCTAGAAAGGGAAAGG - Intronic
1131086698 15:89581625-89581647 CAATATGCCTAGAAGGAGTGGGG + Intronic
1131149860 15:90040507-90040529 CATTAAGCCAAGAAACAGAAGGG - Intronic
1132377554 15:101340051-101340073 CATTATGGCAAGTAAGAGAAAGG + Intronic
1136654788 16:31703353-31703375 CATCATACCCACAGGGAGAAGGG - Intergenic
1137346732 16:47668699-47668721 CATTATGCCCAGAAAAATGAGGG + Intronic
1138606851 16:58095200-58095222 CTTTATGCCCACAGGCAGAAGGG + Intergenic
1139600864 16:67986179-67986201 CACTGTGCCCAGATGGAGTAGGG - Intergenic
1141255905 16:82402098-82402120 CATTTTGCCCTGAGGGAGATGGG + Intergenic
1144063980 17:11607895-11607917 CTTTATCCCCAGGAGCAGAATGG + Intronic
1144100395 17:11937584-11937606 CAAAATGGCCAGCAGGAGAAAGG - Intronic
1144238049 17:13281724-13281746 TATTATGACCATAAGGAAAATGG + Intergenic
1146957360 17:36943251-36943273 CGGTCTCCCCAGAAGGAGAATGG - Exonic
1148743886 17:49907871-49907893 CACTGTGCCCAGAAGGAGAGAGG - Intergenic
1151997427 17:77618742-77618764 CATTCTGGACAGAAGGTGAAGGG - Intergenic
1152009428 17:77702191-77702213 CATGATGGCAGGAAGGAGAAGGG + Intergenic
1156401964 18:36747699-36747721 TGTTGTGCCCACAAGGAGAATGG + Intronic
1164013723 19:21233452-21233474 CATTATGACAGGAAGCAGAATGG + Intronic
1164853390 19:31502602-31502624 CCTTATTCCCACAAGGATAAAGG - Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
927460421 2:23293944-23293966 CCTTGTTCTCAGAAGGAGAAAGG - Intergenic
927804189 2:26130943-26130965 CAAAAAGCCCAGAAAGAGAAAGG - Intronic
929031328 2:37652295-37652317 CGTTCTGCCCAGAAGGAAGAAGG + Intronic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
930613419 2:53568178-53568200 CATTATGTCAAGTAGGAGGATGG - Intronic
930640295 2:53847553-53847575 CATTATTTCAAGAGGGAGAATGG + Intergenic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
936029521 2:109059859-109059881 CACTGTGCCCAGGAGGATAATGG + Intergenic
936816084 2:116462786-116462808 AAATATGCCCAAAAGGAGAATGG + Intergenic
937724883 2:125151009-125151031 CATTATACCCATGAGGAGAGTGG - Intergenic
937936270 2:127248123-127248145 CATTATGCCCAAGAAGAGGAAGG - Intergenic
938172240 2:129089483-129089505 CACTTTGCCCTGAAGGAGAAAGG - Intergenic
941051840 2:160743358-160743380 CCATAAGCCCAGAAGTAGAAAGG - Intergenic
941465422 2:165820512-165820534 CATTATGCCCAGAATAAAACTGG + Intergenic
941586197 2:167362619-167362641 AATAAGGCCCAGAAGGAAAAAGG - Intergenic
942322014 2:174744012-174744034 CACTTTGCATAGAAGGAGAATGG + Intergenic
943897846 2:193390235-193390257 CATAAAGTCCACAAGGAGAAAGG - Intergenic
944408761 2:199415810-199415832 CATCATGCCAGGAAAGAGAAGGG - Intronic
946343470 2:219088041-219088063 CATAATGGCTAGAAGGAAAAAGG + Intronic
946486367 2:220104465-220104487 CATTTTCCCCAAGAGGAGAAGGG - Intergenic
947455530 2:230250535-230250557 CCTGATGCCCAGTATGAGAAAGG + Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948911332 2:241004639-241004661 CATGAGGGCCAGAAGGAAAATGG - Intronic
1169688296 20:8301621-8301643 CAGCATGACCAGAAGGACAATGG - Intronic
1169709116 20:8541427-8541449 CCATGTGCCCAGAAGGAGAATGG - Intronic
1170063637 20:12287112-12287134 GCTTAAGCCCAAAAGGAGAAAGG + Intergenic
1170761971 20:19258911-19258933 AATTATTGCCAGAAGGAGATAGG - Intronic
1171186930 20:23129364-23129386 CATTAGGCAAAGAATGAGAATGG - Intergenic
1173248748 20:41353571-41353593 TATGATGCCCAGAGGGGGAAAGG + Intronic
1173281880 20:41635790-41635812 GGTTATGCCCAGAAGGAGTGAGG - Intergenic
1173910256 20:46663360-46663382 GATTAAGCCCAGGAGGCGAAGGG + Intronic
1174707190 20:52669076-52669098 CATGATGCTCAGAAGCACAAAGG - Intergenic
1177628273 21:23693284-23693306 CTTTATACCCAGAAGTGGAATGG + Intergenic
1177960467 21:27660377-27660399 CAGTATGGCCACATGGAGAATGG + Intergenic
1178903415 21:36615861-36615883 CTTTATGTCCAGATGGAGAAAGG - Intergenic
1180180646 21:46117386-46117408 CAGCTTGCCCTGAAGGAGAAGGG - Exonic
1183589682 22:38772741-38772763 CATTTTACCCACAAGGAGAATGG + Intronic
1185031797 22:48447680-48447702 CAATATGGCCAGGAAGAGAATGG + Intergenic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
1185236773 22:49718408-49718430 CAGTTTGCCAGGAAGGAGAAAGG - Intergenic
950150021 3:10679642-10679664 CTTTATCTCCAGCAGGAGAATGG + Intronic
951277941 3:20712390-20712412 CATTATGCCGAGAAGGAATGGGG + Intergenic
951549804 3:23865674-23865696 CATTATCCCCAAACAGAGAAGGG - Intronic
951631556 3:24726905-24726927 CATAATGCCCAGGAGGACATTGG - Intergenic
952974034 3:38679047-38679069 CAGGATGCCCAGAAGGACCAAGG + Intergenic
955578660 3:60394826-60394848 CATTAAGTCCAGAAGGATAGTGG + Intronic
955822704 3:62913137-62913159 AAGTAAGCCAAGAAGGAGAAGGG - Intergenic
956047755 3:65214546-65214568 GATGAGGCACAGAAGGAGAAAGG + Intergenic
956969965 3:74511410-74511432 CTTTATGCCTTGAAGGATAAAGG - Intronic
957557330 3:81779567-81779589 CATGGTGGCAAGAAGGAGAAGGG + Intergenic
958482451 3:94660463-94660485 AATTATGCCCAGCAGGAAACTGG + Intergenic
959345524 3:105190019-105190041 CAATATGCCCAAAAGGAAGATGG - Intergenic
959740210 3:109710215-109710237 CATCAAGCCCAGAAAGGGAAAGG - Intergenic
960573509 3:119207431-119207453 TACTAGACCCAGAAGGAGAAAGG - Intergenic
960580463 3:119274021-119274043 CAATAGGCCCAGAAAGAGAAGGG - Intergenic
961710003 3:128820793-128820815 CTTTATGCCAGGAAAGAGAAAGG + Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
963434567 3:145251634-145251656 CATCATGGCCAGAACCAGAATGG - Intergenic
966995031 3:185271256-185271278 CATAATGCCCAGAAGGCAAACGG + Intronic
967954885 3:194870474-194870496 CCAGATGCCCAGAATGAGAAGGG - Intergenic
969377736 4:6774021-6774043 CATTATGCCTAGAAGCCAAACGG + Intergenic
971127342 4:23768860-23768882 GATTAAACCCAGAAAGAGAAGGG + Intronic
972385523 4:38562107-38562129 CACACTGTCCAGAAGGAGAAAGG + Intergenic
972791616 4:42376985-42377007 CATTATCTCCAGCTGGAGAATGG - Intergenic
973312654 4:48726273-48726295 CATTATGCCCAGAAGGAGAAGGG - Intronic
974316138 4:60282924-60282946 CAGTATGGCCACATGGAGAATGG - Intergenic
975741305 4:77431841-77431863 CATTTTGCCTGGAAGGGGAAAGG + Intronic
978308917 4:107364147-107364169 CATGATGGCAACAAGGAGAAGGG - Intergenic
979058972 4:116030540-116030562 CATGATGGCATGAAGGAGAAGGG - Intergenic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980342470 4:131568225-131568247 CATTATGCCCAGGAATAGAAAGG - Intergenic
980955755 4:139427690-139427712 AATCATGGCCAGAAGGTGAAGGG + Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984865127 4:184274638-184274660 CAGTATGCACAGATGGTGAAAGG - Intergenic
986547655 5:8916394-8916416 AACTATGCACAGAAGTAGAAAGG - Intergenic
987322486 5:16783636-16783658 CAATGTGGCCAGCAGGAGAAAGG - Intronic
987363537 5:17127991-17128013 GAATAGGGCCAGAAGGAGAAGGG - Intronic
987774399 5:22345799-22345821 AATTATGTCAAAAAGGAGAATGG + Intronic
988508658 5:31846550-31846572 CATGATGCCCAGAATTAAAAAGG - Intronic
988974174 5:36498982-36499004 CATTCTTCCCAGGAGGTGAAAGG + Intergenic
991593424 5:68278088-68278110 CACAATGCCCAGCAGAAGAAAGG - Intronic
993013625 5:82511194-82511216 CATTTTGCCCTGAGGGAGACTGG + Intergenic
994749276 5:103718775-103718797 AATTAGCCCCAGAAAGAGAAAGG - Intergenic
995539348 5:113169277-113169299 CAAGAAACCCAGAAGGAGAAAGG + Intronic
995947645 5:117668808-117668830 AATGATGCCCAGAATCAGAAGGG - Intergenic
998129177 5:139642811-139642833 AATTATCTCCAGGAGGAGAAAGG + Intergenic
998669005 5:144332674-144332696 CAATATGCCCATAAGGAGTTAGG + Intronic
1002317949 5:178356558-178356580 CCTTCTTCCCAGAAAGAGAAAGG + Intronic
1003411868 6:5872021-5872043 CAGTGTGCCCAGAAGAGGAATGG - Intergenic
1003783762 6:9459836-9459858 AATTATGGCCTGAAGGAGAATGG + Intergenic
1004765513 6:18722122-18722144 CATTTTGCACAGAAAGAGAGAGG - Intergenic
1006702471 6:35987043-35987065 CATAAAGCCCAGAAGCTGAAAGG - Intronic
1008728546 6:54452118-54452140 GATTATGCCCAGAGAGAGACAGG - Intergenic
1011696297 6:89916549-89916571 CAATGTCCCCAGAAGGTGAAGGG - Intergenic
1013979336 6:116111042-116111064 CATCCTGCCCAGCAGGGGAAAGG - Intronic
1015579428 6:134707389-134707411 CAATATGCCCAGAACTAAAAAGG + Intergenic
1015875374 6:137817229-137817251 CTTTATGCTGAGAAGAAGAAAGG + Intergenic
1017579770 6:155850824-155850846 CCATTTGCTCAGAAGGAGAAAGG + Intergenic
1019220372 6:170468402-170468424 CATTCTCCCCAGAAGAAGGAGGG - Intergenic
1021636817 7:22702098-22702120 CATTGTGCCCAGAAGGGGAATGG - Intergenic
1021682604 7:23149439-23149461 CAATATTCCCAGTAAGAGAAAGG - Intronic
1022247196 7:28571717-28571739 CCTTATCCCCAGAATGAGGATGG + Intronic
1024533763 7:50413252-50413274 CATAATGCAAAAAAGGAGAATGG + Intergenic
1026034792 7:66823231-66823253 CAGTTTGCCCAGATGCAGAATGG - Intergenic
1026595497 7:71731206-71731228 CATCCAGCCCAGAAGGAGAAAGG - Intergenic
1027504286 7:78996119-78996141 TATTGTTCCCAGAGGGAGAATGG - Intronic
1027545500 7:79522780-79522802 CATTATACACACAAGGAAAATGG - Intergenic
1028226489 7:88257964-88257986 CAATATGCCCAGTAAGATAAAGG - Intergenic
1028967566 7:96819294-96819316 CATTTTGTCTAGAATGAGAATGG - Intergenic
1029308901 7:99643198-99643220 CATTATGTGCAGGATGAGAAAGG + Intergenic
1029973964 7:104815325-104815347 GATTACCCCCAGCAGGAGAAGGG + Intronic
1031017608 7:116592821-116592843 CATTTTCCCCAGAATGACAATGG - Intergenic
1032526764 7:132583708-132583730 AAATAGGGCCAGAAGGAGAATGG - Intronic
1032613619 7:133442716-133442738 GATTTTGACCACAAGGAGAAGGG + Intronic
1033058266 7:138080027-138080049 CATTAGGCCCAGAATGGGGAGGG - Intronic
1035567801 8:653087-653109 GTTTATGCCCAGAAGTGGAAGGG - Intronic
1035771197 8:2148237-2148259 CATTCTGCCCTGAGGGAGTAGGG - Intronic
1038027324 8:23603337-23603359 CATTGAGGCAAGAAGGAGAAAGG - Intergenic
1038637527 8:29299815-29299837 CATAATATCCAGAAGGAGAGAGG + Intergenic
1040101988 8:43513670-43513692 CTTTATGTCCAGATGCAGAAAGG + Intergenic
1041172994 8:55164282-55164304 CATCCTGCCCACTAGGAGAATGG - Exonic
1045421981 8:102025527-102025549 TATTATGTACAGAAGGAGTAAGG - Intronic
1047625149 8:126648798-126648820 CATTATGCCCATGAGGAAAGGGG - Intergenic
1048103928 8:131386694-131386716 CCATATGCCAAGAAGGAGATTGG + Intergenic
1049633860 8:143675109-143675131 GAATATGCCCAGAAGTGGAATGG - Intergenic
1050285264 9:4095244-4095266 ATTTATGTCCAGAAGTAGAAAGG - Intronic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1055122299 9:72675582-72675604 CATCATGCAGAGAAGGACAATGG - Intronic
1056515375 9:87344550-87344572 CATTTTCCCCAGATGGAGAGTGG - Intergenic
1056826182 9:89877900-89877922 CAGTATGCACAGAAGGCAAACGG - Intergenic
1058314242 9:103544471-103544493 GGTTATGCCCAGAAAGAGACAGG - Intergenic
1058520260 9:105809145-105809167 CATAATGTCCAGAAGGGGAGAGG + Intergenic
1060538413 9:124411470-124411492 CATTCTACACAGAAGGAAAAAGG + Intronic
1062195578 9:135271960-135271982 CATTATGCCAACAAGTTGAATGG - Intergenic
1062333975 9:136056862-136056884 CTTTCTTCCCAGATGGAGAAGGG + Intronic
1186042408 X:5495467-5495489 CATGGTGCCCAGTGGGAGAAAGG - Intergenic
1186339601 X:8630043-8630065 CATTCTGCCCTGAGGGAGCATGG + Intronic
1187061298 X:15789735-15789757 CCCTTTACCCAGAAGGAGAAGGG - Intergenic
1187570855 X:20499916-20499938 CACTATGCTCTGAAGGAGAAGGG + Intergenic
1187963279 X:24586338-24586360 AATGATGCCAAGAAGGAGATAGG + Intronic
1188312858 X:28639169-28639191 CATTGCTCCCAGAGGGAGAATGG - Intronic
1189835282 X:45014455-45014477 AAAGATGCCCAGAAGGATAAAGG + Intronic
1194429056 X:93777981-93778003 CATTCTAGCCAGAAGGACAAAGG + Intergenic
1195745189 X:108110285-108110307 CCTTAAGCCCAGAAAGAGGAGGG + Intronic
1198333374 X:135642942-135642964 CATTATGCCAAGAGGTAAAAAGG - Intergenic
1198337273 X:135678958-135678980 CATTATGCCAAGAAGTAAAAAGG - Intergenic
1198361923 X:135903876-135903898 CATTATGCCAAGAGGTAAAAAGG + Intronic
1201377518 Y:13339307-13339329 GTTTCAGCCCAGAAGGAGAATGG + Intronic