ID: 973316676

View in Genome Browser
Species Human (GRCh38)
Location 4:48767823-48767845
Sequence TAATCCTGGATTGCAGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973316676 Original CRISPR TAATCCTGGATTGCAGCTAC GGG Intronic
910499103 1:87868824-87868846 AAATCATGGGTTGCAGCTAAAGG + Intergenic
910596770 1:88989654-88989676 TAAGCTTGGAGTGCAGCTTCTGG + Intronic
913091508 1:115479383-115479405 CAAGCCTGGATGGCAGCTGCGGG - Intergenic
919759515 1:201088551-201088573 TAATTCTGGATTGGAGCCAGGGG + Intronic
1069981076 10:72252971-72252993 TAATCCAGGATTCCAGCATCTGG - Intergenic
1074283900 10:112079931-112079953 AAATCATGTATTGCAGCTACTGG - Intergenic
1075982288 10:126750462-126750484 TAATCCAGGAATGCCACTACTGG - Intergenic
1076462769 10:130657635-130657657 TATTCCTGGAGTGCATCTACAGG - Intergenic
1079011487 11:16832210-16832232 TAACCCTGGATTCCTGCTATGGG + Intronic
1099685050 12:85874441-85874463 TACTCCTGGCTTTCAGCTCCTGG + Exonic
1104548552 12:129734017-129734039 TGATACTGGATTGCAGCTGTGGG - Intronic
1106956866 13:34948926-34948948 CTATCTTGGATGGCAGCTACAGG - Intronic
1108531962 13:51335754-51335776 TGATCCTGGCTTCCAGCTTCTGG - Intronic
1111191015 13:84806272-84806294 GACTCCTGGATTGCATTTACAGG - Intergenic
1117080785 14:52150304-52150326 TAATACTGGGTTGCACCTGCTGG + Intergenic
1120649552 14:87115384-87115406 TAATTCTGGCTTGTAGCTGCTGG - Intergenic
1126012751 15:44318869-44318891 TAATTCTCTGTTGCAGCTACTGG + Intronic
1134295630 16:12943009-12943031 CAATTCTGGTTTGCAGCTGCTGG - Intronic
1135790892 16:25394472-25394494 TAATCCAGCATTGCAGCCACTGG - Intergenic
1135931717 16:26743612-26743634 TGATTCTGGAGTGCAGCTGCTGG - Intergenic
1143130804 17:4675824-4675846 AAATCCTGGATTTCATCTGCCGG - Exonic
1153513152 18:5877496-5877518 TAGCCCAGAATTGCAGCTACGGG - Intergenic
1155247033 18:23920377-23920399 TACACCTGGATTGGAGCTACAGG + Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1166328439 19:42065372-42065394 TCATCCAGGATTGCAGCTGAGGG + Exonic
1166652761 19:44586836-44586858 TGATCCTGGACTGAAGCTTCAGG + Intergenic
1167033338 19:46978173-46978195 TTATCCTAGATTGCAGGGACTGG + Intronic
1167789455 19:51664089-51664111 TAGTACTGGATTGCAACTAGAGG + Intergenic
926883523 2:17575169-17575191 TCCTTCTGGATTGCAGGTACTGG + Intronic
931493720 2:62778963-62778985 TAATCCCAGTTTGGAGCTACAGG - Intronic
937878050 2:126840492-126840514 GAATCCTGGATTGGAGGTCCTGG - Intergenic
942024302 2:171897203-171897225 AAAACTTGGGTTGCAGCTACAGG + Intronic
947984768 2:234438560-234438582 CATCCCTGGATAGCAGCTACGGG + Intergenic
1177928258 21:27246986-27247008 TCACCATGGATTGCAGCTAGTGG - Intergenic
960601357 3:119462104-119462126 TTAACCTGGGTTGCAACTACAGG - Exonic
960965941 3:123104765-123104787 TAATCCTGGCTCACAGCTACTGG - Intronic
963978249 3:151507115-151507137 TGATTCTGGCTTGCAGCTGCTGG - Intergenic
964896176 3:161598931-161598953 TAATCCTGCATTTTAGCTCCTGG + Intergenic
967016872 3:185490167-185490189 CAATTCTGTACTGCAGCTACAGG + Exonic
973316676 4:48767823-48767845 TAATCCTGGATTGCAGCTACGGG + Intronic
980602658 4:135045037-135045059 TACTCCTGGTTTACAGCCACAGG - Intergenic
982124165 4:152169916-152169938 AAATCCTGGATGGCAGCTGTAGG + Intergenic
982307523 4:153948450-153948472 TAAACTAGGATTGCAGCTCCAGG - Intergenic
983654549 4:170069522-170069544 TAATCCTGGATTTCAACCTCTGG - Intronic
984339928 4:178444056-178444078 GAATCCTTCATTGCAACTACAGG + Intergenic
987377444 5:17249333-17249355 AAATCCTGACTTGCTGCTACAGG - Intronic
993159869 5:84276258-84276280 TAAAACTGGATTGCAGCAAGAGG - Intronic
996735365 5:126753605-126753627 TAATCATGTATTACAGCTAAAGG + Intergenic
1002097856 5:176842336-176842358 TAATCCAGGAATGCCACTACTGG + Intronic
1003187148 6:3841839-3841861 TCATCCTGGAAAGCAGCTCCAGG + Intergenic
1005970033 6:30753502-30753524 TAATTCTGGATGGCAGGTTCAGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1010749399 6:79601055-79601077 TGATCCTGGTTTGCAGATTCAGG - Intergenic
1011840730 6:91495275-91495297 TAATCCTGTATATCAGTTACTGG + Intergenic
1014781528 6:125570677-125570699 TAATCCAGGATTGCTCATACAGG + Intergenic
1014916400 6:127154695-127154717 TAATGCTGATTTGCAGGTACTGG - Intronic
1015636329 6:135278644-135278666 TAGTCCTTAATTCCAGCTACTGG + Intergenic
1020899138 7:13981881-13981903 TAATCCTAAATTGAAGCTACAGG + Intronic
1021611503 7:22462158-22462180 TAATCCAGGAGTGAAGCTAGGGG - Intronic
1034408438 7:150922260-150922282 TGATCCTGGATTGCAGCTAGTGG + Intergenic
1043918910 8:85958565-85958587 TCATCCAGGATTACAGGTACTGG + Intergenic
1045989562 8:108289791-108289813 TCATGCTGGAATGCAGCTAACGG - Intronic
1047844678 8:128793200-128793222 TAAGCCTGGAGTGAAGCAACTGG - Intergenic
1049264136 8:141657830-141657852 TAATCGGGGATTGCAGCTACTGG + Intergenic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1060035191 9:120249361-120249383 TAGTCATTCATTGCAGCTACAGG + Intergenic
1189716419 X:43871144-43871166 TTATCCTGGATTGAAGCAAGAGG + Intronic
1201525732 Y:14931952-14931974 TAACCCTGGTTTTCAGCAACAGG + Intergenic