ID: 973321327

View in Genome Browser
Species Human (GRCh38)
Location 4:48813277-48813299
Sequence CTTGTAAGAATCAGTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973321327 Original CRISPR CTTGTAAGAATCAGTATTGT GGG Intronic
906337991 1:44951380-44951402 CCTGTTAGAATCAGAATTGCTGG - Intronic
907156002 1:52334515-52334537 GTTGTAAGCATCAGAATTGTTGG + Intronic
908311208 1:62886288-62886310 CTTGAACGAGTCAATATTGTTGG + Intergenic
908962164 1:69711058-69711080 CCTGTAAGAATCAGAGTTGGAGG - Intronic
909226055 1:73024276-73024298 CTTCTATTCATCAGTATTGTTGG - Intergenic
910481667 1:87664734-87664756 CCTGTAATTCTCAGTATTGTGGG + Intergenic
913256092 1:116955051-116955073 TTTGTAAAAACAAGTATTGTGGG - Intronic
913384894 1:118248896-118248918 CTTGTAAAACTCAGTACAGTAGG - Intergenic
913545014 1:119859573-119859595 CTTGATGGAATCAGTATAGTGGG - Intergenic
914424807 1:147565982-147566004 ATTGTAAGAAACAGTAGTTTGGG - Intronic
914687911 1:149998295-149998317 ATTGTATGAATTAGTATTTTAGG - Intronic
917354196 1:174108950-174108972 CTGGTAAGAAAGAGGATTGTGGG + Intergenic
918847592 1:189638363-189638385 CTTGTATGAATGGGTATTATTGG + Intergenic
918964422 1:191323463-191323485 TTTGTAAGAATCATTATTCATGG - Intergenic
919248698 1:195024443-195024465 CTTGTAAGAAAAACTATTGCTGG - Intergenic
919296946 1:195714018-195714040 CTTGAAAGAATAAGAATTTTAGG + Intergenic
920613178 1:207462398-207462420 CTGGAAAAAATCAGTGTTGTTGG + Intronic
920905465 1:210161092-210161114 CTTGGTAGAAACAGTAATGTTGG - Exonic
922629227 1:227087630-227087652 ATTGGAAGACTCAATATTGTTGG - Intronic
1065192251 10:23223578-23223600 AAGGTAAGAATCATTATTGTTGG - Exonic
1065605910 10:27417766-27417788 CTTGTAAGAAGAATTATTTTTGG + Intergenic
1066601324 10:37110613-37110635 CTAGGCAGAATTAGTATTGTTGG + Intergenic
1068281477 10:54876439-54876461 CTTGTAAGAATCACTATCTATGG - Intronic
1072559334 10:96556278-96556300 CAGGTAAGAGGCAGTATTGTTGG - Intronic
1073278737 10:102335564-102335586 CTTGTAGGAAGCAGTAAAGTCGG + Intronic
1073638065 10:105219785-105219807 CTTGGCAGAATCAGAAATGTGGG - Intronic
1073745052 10:106458874-106458896 GTTGTCAGCATGAGTATTGTTGG + Intergenic
1074507349 10:114083222-114083244 CTTATAAGACTCTGTGTTGTAGG - Intergenic
1076151580 10:128166367-128166389 CTTGTCAAAACCAGTATTGTTGG + Intergenic
1076361966 10:129895872-129895894 TTTGAAAGAATCCGTAATGTGGG + Intronic
1077820306 11:5731007-5731029 CTTGTAAGAGTAAGCAATGTAGG + Intronic
1079041731 11:17065701-17065723 CATGAAGGAATCAGTATTTTAGG + Intergenic
1079531363 11:21458165-21458187 CTTGTAAGAACCAGTAGAGAGGG + Intronic
1088741076 11:112767266-112767288 ATTGTAATAATAATTATTGTTGG - Intergenic
1090695292 11:129235068-129235090 CTTATAAGGATAATTATTGTTGG - Intronic
1095816448 12:46427671-46427693 ATTGGAGGAATCAGTATCGTTGG + Intergenic
1095881147 12:47138048-47138070 TTTTTAAGAAACAGTAATGTGGG - Intronic
1097577575 12:61413977-61413999 CTTGTTAGATTCATTAGTGTTGG - Intergenic
1099910202 12:88822019-88822041 ATTGTCAAAATAAGTATTGTTGG + Intergenic
1100509968 12:95260905-95260927 AATGTTAGAATCAGAATTGTGGG + Intronic
1106843933 13:33717390-33717412 CGTATAAAAATCAGTAGTGTTGG + Intergenic
1108337440 13:49459684-49459706 TTTTTAAAAAGCAGTATTGTTGG + Intronic
1110098007 13:71555640-71555662 ATTGTAAAAATTAGTATAGTGGG - Intronic
1113753568 13:112793065-112793087 TTGGTAATAATCAGTATTGGTGG - Intronic
1113980033 13:114266994-114267016 CCTGTAAGATTCAGTAATATTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115786449 14:36831334-36831356 CCTGTAAGACACTGTATTGTAGG + Intronic
1116693271 14:48138499-48138521 CTTTTGATAATCAGTATAGTTGG + Intergenic
1118345292 14:64935816-64935838 GTTGTAAGATACAGTATAGTTGG + Intronic
1119453605 14:74734918-74734940 CTTGTAAGAATTAGAATCGAGGG - Exonic
1119686604 14:76637595-76637617 CTTATAAAAAGCAGTCTTGTGGG + Intergenic
1124175599 15:27421456-27421478 CTTAGAATACTCAGTATTGTTGG - Intronic
1124175632 15:27421691-27421713 CTTAGAACACTCAGTATTGTTGG - Intronic
1126794326 15:52247634-52247656 CTTGTATGAGTGAGTACTGTGGG - Intronic
1127029520 15:54846361-54846383 CTTGAAAGAATGAATATTATAGG - Intergenic
1130349397 15:83077961-83077983 TTTGAAAGGATGAGTATTGTAGG + Intergenic
1135935175 16:26773850-26773872 CTTGGAAGACTCAGCAATGTTGG - Intergenic
1137310437 16:47251453-47251475 CTTAAAAGAATCAGTGTTGGTGG - Intronic
1142333344 16:89470215-89470237 CTTGTAAGAATTGGGATTATAGG - Intronic
1147838716 17:43354937-43354959 ATACTTAGAATCAGTATTGTGGG + Intergenic
1148247191 17:46040757-46040779 ATTGAAAGATTCAGTATTGGTGG - Intronic
1149207104 17:54261005-54261027 TTTGTAAGAACCAGTCGTGTTGG - Intergenic
1150702901 17:67463412-67463434 CTTGTAAGAATTGGTAGTTTGGG - Intronic
1153355769 18:4133751-4133773 CATGTCAGAAACAGTATTTTGGG + Intronic
1153733775 18:8043615-8043637 CATGGAAGCATCAGGATTGTAGG - Intronic
1153845904 18:9049691-9049713 CTTGTGAGCATAAGTATTGGTGG - Intergenic
1155406822 18:25497778-25497800 CTTGAAAGATTCAGAATTGATGG - Intergenic
1158702659 18:59762717-59762739 GTTGTAATAACCAGTATTGAAGG + Intergenic
1161497594 19:4596130-4596152 CTTGTAAGTATTATTATTGGTGG + Intergenic
1164279308 19:23755026-23755048 CTTTTATAAATCAGTATTTTGGG - Intronic
1164310981 19:24046048-24046070 CTGGTAGGAAACAGTATTTTGGG + Intronic
1165443025 19:35841705-35841727 CTTGTCAGCATCAGTATGGAGGG - Exonic
1168561054 19:57383614-57383636 CTTCTAAGAATCAGAAGTTTAGG - Intronic
925960450 2:9009651-9009673 CTTGTGATAAACAGTATTTTAGG - Intergenic
929843441 2:45496369-45496391 CTTTTAATAGTCAGTATTATTGG - Intronic
931139624 2:59443278-59443300 CTTATAAGAACCAGTCCTGTTGG + Intergenic
931409286 2:62013514-62013536 CTAATAAAAATCAGTATTGTAGG + Intronic
934533783 2:95115312-95115334 CTTTTAAGAATCAGATTTTTAGG + Intronic
936688050 2:114851699-114851721 CATGTAAGGATCATTAATGTTGG - Intronic
940936644 2:159503068-159503090 CTTGGTAGAAACAGTATTGAAGG - Intronic
941931461 2:170944654-170944676 CTAGTAAGAATCAGTATGCAGGG + Intronic
942471556 2:176266339-176266361 CTGGAAAGAATCTGTAATGTGGG - Intergenic
943086232 2:183315101-183315123 CTTGGAAGCATCACTTTTGTGGG - Intergenic
943133176 2:183881684-183881706 ATTGTAGGACTCAATATTGTTGG - Intergenic
944697663 2:202217460-202217482 CTTGTAATTATCCGTATTTTTGG - Intronic
945810722 2:214546743-214546765 CTTGTAACATTCAGTGTTCTTGG - Intronic
1170617373 20:17965020-17965042 CATGTAAAAATTAGCATTGTTGG - Intronic
1175003073 20:55651084-55651106 ATTGGAAGAATCAGTATAGCTGG - Intergenic
1177137695 21:17323928-17323950 ATTAGAAGAATCAGTATTGTTGG + Intergenic
1179394784 21:41028861-41028883 CTTGTAACATTAAGTATTGCTGG + Intergenic
951715881 3:25645399-25645421 CTTTGAAGAATCATTTTTGTTGG + Exonic
953489837 3:43340227-43340249 CTTGCAAGGATCAGTAATGATGG - Intronic
970213889 4:13738588-13738610 CTTGACAGAATCAGTTTTGGTGG + Intergenic
970714262 4:18902981-18903003 ATTGTAACAATCAGTATTTATGG - Intergenic
970874823 4:20857334-20857356 CTTGTAAGAGCCTGTATTTTGGG + Intronic
973321327 4:48813277-48813299 CTTGTAAGAATCAGTATTGTGGG + Intronic
978581842 4:110239654-110239676 CTTGACAGATTCAGTATTGAAGG + Intergenic
979361784 4:119773770-119773792 ATTGTAATAACCAGTATTGGAGG - Intergenic
980545521 4:134256644-134256666 CTTTTAAAAATCAATATTCTAGG + Intergenic
981045096 4:140257463-140257485 CTTGTAAGAGCCAGTATTTAAGG + Intronic
981357547 4:143807330-143807352 CTTGCAAGAAGCAGTACTCTAGG - Intergenic
981369013 4:143936869-143936891 CTTGCAAGAAGCAGTACTCTAGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989690673 5:44139633-44139655 GTTGAAAGAATCACTATTGCTGG - Intergenic
991083741 5:62628696-62628718 CTAGTAGGTATCAGTATTGCAGG + Intergenic
992416310 5:76555639-76555661 CCTGTAAGGTTCAGTAGTGTAGG + Intronic
993136346 5:83970747-83970769 CTTGTAAGAATCACTCAGGTAGG - Intronic
993448971 5:88050628-88050650 CATGCAACAATCATTATTGTGGG - Intergenic
993554881 5:89323821-89323843 CTTCTAAGAATTTGTATTGAGGG - Intergenic
994777590 5:104054510-104054532 GTTGTACTAATCAGTATAGTGGG - Intergenic
996216578 5:120874491-120874513 ATTTATAGAATCAGTATTGTGGG + Intergenic
996897866 5:128506273-128506295 GTTGGAAGACTCAATATTGTGGG - Intronic
997170759 5:131717828-131717850 CTTTTAAAAATCAGTATTTTTGG + Intronic
1001469563 5:172001348-172001370 ATTGTGAGAATTAGTAATGTGGG + Intronic
1003835826 6:10071537-10071559 CCTGGAAGAATCAGTTCTGTTGG - Intronic
1004654020 6:17640921-17640943 CTTTTAAGAATGATTTTTGTGGG - Intronic
1008051262 6:46902501-46902523 TTTGTAAGAATCAGGATCATTGG + Intronic
1010365483 6:75046376-75046398 CTGGTAAGAATGGCTATTGTTGG + Intergenic
1011410893 6:87065041-87065063 CTGGAAACAATTAGTATTGTTGG - Intergenic
1013103221 6:107004897-107004919 GTTGTTATAATCAGTATTTTTGG - Intergenic
1013746723 6:113354732-113354754 CTTGAAGGCATCAGTATTATTGG - Intergenic
1014413938 6:121160991-121161013 CTTGTTAGAATAAATCTTGTTGG - Exonic
1014652487 6:124057161-124057183 CTTGTAAAAATCAATCTTTTTGG + Intronic
1016964001 6:149701150-149701172 CTTGTAAGCATGAATATTTTAGG - Intronic
1020695678 7:11411027-11411049 TATGTAGGAATCAGTAGTGTTGG + Intronic
1021080813 7:16362234-16362256 GCTGTGAGAATAAGTATTGTTGG - Intronic
1021144769 7:17071416-17071438 CTTATAAGAATGAGAATTTTTGG - Intergenic
1021349293 7:19570078-19570100 ATTGCAATAATCAGAATTGTAGG - Intergenic
1024058381 7:45680954-45680976 CTCGCAAGAATCAGTATTCCTGG - Intronic
1033399195 7:141005816-141005838 CATGTAAGTTTCAGTCTTGTGGG - Intergenic
1033668516 7:143466623-143466645 CTTGTAAGTATCTGTCTTTTTGG + Intergenic
1033932544 7:146542161-146542183 CTTCTAAAAATCAGTTTTGATGG + Intronic
1037032387 8:14125179-14125201 ATAGTAAGAATCACTATTGTTGG + Intronic
1037964249 8:23120887-23120909 CTTGGATGAATGAGTACTGTGGG + Intergenic
1040666541 8:49640685-49640707 CTTCAAAGAATCTGTATTTTAGG + Intergenic
1040732319 8:50463346-50463368 CTCGTAGGAATCACTATTTTTGG + Intronic
1041395545 8:57387284-57387306 CATTTAAGAATCAGTTCTGTAGG + Intergenic
1044595857 8:93957635-93957657 TTTGTTAGAAGCTGTATTGTAGG + Intergenic
1045200093 8:99971764-99971786 ATAGGAAGAATCAGTATCGTGGG + Intronic
1046564097 8:115876492-115876514 CTTGGAAGAAGCAGAGTTGTTGG - Intergenic
1046900324 8:119516707-119516729 TTGGTAAGAAACAATATTGTTGG + Intergenic
1046970931 8:120222709-120222731 CTTTTAAGAAACAGTTTTTTTGG + Intronic
1048968346 8:139629966-139629988 CATGAAAGAACAAGTATTGTAGG + Intronic
1050735167 9:8753842-8753864 CTTAAAAGACTCATTATTGTAGG + Intronic
1052402097 9:28013147-28013169 CTAGTAACAATCAGGATTTTAGG + Intronic
1055389627 9:75806054-75806076 CTTGTGAGCTTCAGAATTGTAGG + Intergenic
1058642404 9:107100385-107100407 CTTCTAGGAATCAGGAATGTTGG - Intergenic
1059229711 9:112708159-112708181 TTTATAACAATCATTATTGTAGG + Intronic
1187237978 X:17486006-17486028 CTTCTAAGAATCAGCATATTAGG + Intronic
1187351864 X:18526045-18526067 ATTATAAGACTCAATATTGTTGG - Intronic
1189941375 X:46125908-46125930 CCTGTCAGAATCAATATTTTTGG - Intergenic
1192867402 X:75149713-75149735 CTTGTAGGAAAAAGTGTTGTAGG + Intronic
1193828667 X:86260326-86260348 CTTGAGAGTATCAGAATTGTAGG - Intronic
1196038109 X:111169411-111169433 CTTGTAAGAATTAGAACTGAAGG - Intronic
1199923595 X:152437399-152437421 ATAGGAAGACTCAGTATTGTTGG + Intronic
1201547225 Y:15178866-15178888 ATTGTAAGATTCAGTGTTGGAGG - Intergenic