ID: 973321569

View in Genome Browser
Species Human (GRCh38)
Location 4:48816101-48816123
Sequence CTGTGTGACTAGCAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973321569 Original CRISPR CTGTGTGACTAGCAGGAAGA AGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900601386 1:3504191-3504213 CTGTGTGACCAGCATGACCATGG - Intronic
902360560 1:15940580-15940602 CTGACTGACTAGGAGGCAGAAGG - Intergenic
903590010 1:24447764-24447786 CTGTGTGACTTGGAAAAAGAAGG + Intronic
903651453 1:24924982-24925004 CTGTCTGAATTCCAGGAAGATGG - Intronic
904894203 1:33801900-33801922 CTGTGTGCTTTGCTGGAAGAAGG + Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
909043090 1:70676879-70676901 CCTTGTGACCTGCAGGAAGATGG + Intergenic
910036613 1:82796593-82796615 CTGTCAGCCTAGCAGTAAGAAGG + Intergenic
910689618 1:89952792-89952814 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
910793021 1:91070579-91070601 CTGAGTTTGTAGCAGGAAGAGGG + Intergenic
910916589 1:92296243-92296265 GTGTGTACCTAGAAGGAAGATGG + Intronic
911906548 1:103576249-103576271 CTGTGTGACTCAGAGGAAGGAGG - Intronic
911913152 1:103661399-103661421 CTGTGTGACTCATAGGAAGGAGG - Intronic
911915302 1:103690549-103690571 CTGTGTGACTCATAGGAAGGAGG + Intronic
911920565 1:103755537-103755559 CTGTGTGACTCATAGGAAGGAGG - Intronic
914804620 1:150983108-150983130 GTCTGTGACTGGCGGGAAGATGG + Exonic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915508197 1:156370657-156370679 CTCTGTGATTAGCAGGTAGATGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
920326740 1:205170835-205170857 CTGTGCTCCAAGCAGGAAGAAGG - Intronic
920365757 1:205447631-205447653 CTGAGTGACAAGCAGGACGGGGG + Intronic
920530187 1:206696086-206696108 CCGTGTGACTGGTAGGATGAAGG - Intronic
922190560 1:223315101-223315123 CTGTAAGACTAGAAGCAAGATGG - Intronic
922334129 1:224605359-224605381 CTGTGGGGCTAGAAGCAAGATGG - Intronic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922493281 1:226035966-226035988 CTCTGTGAGCAGCAGAAAGAAGG - Intergenic
922688310 1:227665289-227665311 ATGTGTAATTAGCTGGAAGATGG - Intronic
924105513 1:240645291-240645313 CTGTGAGACTAGAAGCAAGGTGG + Intergenic
924314786 1:242784597-242784619 TTGTGGGACTAGGAGGGAGATGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062919764 10:1271034-1271056 CTGTGTGACCAGCTGGGATATGG + Exonic
1063113544 10:3056902-3056924 CAGTGGGATTAGCAGGAAGCGGG + Intergenic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1064648242 10:17482094-17482116 CTGTGAGGCTAGAAGCAAGACGG + Intergenic
1065363395 10:24910850-24910872 CTGTCTCCTTAGCAGGAAGATGG - Intronic
1065886946 10:30087049-30087071 CTATCTCACTAGCAGGAATAAGG - Intronic
1066061555 10:31727965-31727987 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1066095921 10:32071968-32071990 CTGTGTAACCCGCAGGGAGAGGG - Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067956554 10:50797456-50797478 TTGTGTGAATATCAGGAAGTGGG + Intronic
1069136603 10:64773982-64774004 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1069685457 10:70315436-70315458 CTGTGTGACTTTCAGCAACAAGG - Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1069806450 10:71128161-71128183 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1070016730 10:72541106-72541128 CTATGAGACTAGAAGCAAGATGG - Intronic
1071708431 10:88025005-88025027 CTGTGTGTAAAGCAGGATGAAGG + Intergenic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1073526153 10:104184142-104184164 CTGTGAGACTAGAAACAAGATGG - Intronic
1074734401 10:116413718-116413740 CTATGTGAGTACCAGGATGAAGG + Intergenic
1075445820 10:122512110-122512132 CTGTGGGGGTAGCAGGAAGAGGG + Intronic
1076204282 10:128582657-128582679 ATTTGCAACTAGCAGGAAGATGG - Intergenic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1077172244 11:1172287-1172309 CTGAGTGTGTAGCAGGATGAAGG + Intronic
1077789960 11:5428676-5428698 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078723726 11:13908775-13908797 CTGTGAGATTAGAAGGCAGAAGG - Intergenic
1082121500 11:48384449-48384471 CTGTGTGGCTCCCAGAAAGAGGG + Intergenic
1085282824 11:75342033-75342055 CTATGTGTCAAGCAGGAAGTAGG - Intronic
1085489926 11:76906036-76906058 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1086984334 11:93232133-93232155 CTTTGAGACTTGCAGGTAGAGGG + Intergenic
1087235850 11:95717909-95717931 CTGGGTGAATAGAAGGTAGATGG - Intergenic
1087272789 11:96128511-96128533 GTGTGTGTCAAGCAAGAAGATGG - Intronic
1088097594 11:106118152-106118174 GTGTGTGAATAACAGCAAGAAGG - Intergenic
1088377998 11:109162755-109162777 CTGTGTGAGTTCCATGAAGAAGG + Intergenic
1088792154 11:113235528-113235550 CCCTGTGACTTGCAGGAAGAGGG + Intronic
1089123464 11:116159653-116159675 CTGTGGGACTAGCAATATGAAGG + Intergenic
1089310836 11:117557187-117557209 GTGGGGGACTTGCAGGAAGAAGG + Intronic
1089423456 11:118349760-118349782 GTGTATGACTATCAAGAAGATGG + Exonic
1089829100 11:121309409-121309431 CTGTGTGCCTGGGAGGAAGGGGG + Intergenic
1089956647 11:122577315-122577337 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1091099233 11:132854876-132854898 CTGTGAGGCTAGAAGAAAGATGG - Intronic
1091215725 11:133900255-133900277 CTGAGTGATGAGCAGGAATAAGG + Intergenic
1091757358 12:3062913-3062935 CTGTGAGGCCAGCAGCAAGATGG - Intergenic
1092938145 12:13383166-13383188 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1094120639 12:26970370-26970392 CCGTGTGAAGAGCAGTAAGAGGG - Intergenic
1094124919 12:27013979-27014001 CTGTCAGCCTAGCAGGGAGATGG - Intronic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1097298188 12:57989753-57989775 CAGTGTAACAGGCAGGAAGATGG + Intergenic
1098289606 12:68945335-68945357 CTGTGAGACTAGAAGCAAGATGG + Intronic
1098291874 12:68964276-68964298 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1098445696 12:70563685-70563707 CTGAGTGACTTGCAGAGAGAAGG - Intronic
1098928764 12:76384543-76384565 CTATGTGACTACCAGGAGGGTGG - Intronic
1099167682 12:79326618-79326640 ATCAGTGATTAGCAGGAAGATGG - Intronic
1099613879 12:84911713-84911735 GTGTGTGACTGGGAAGAAGACGG - Intronic
1100284255 12:93149817-93149839 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1100665838 12:96752144-96752166 CTATGTGAATGGCAGGATGATGG - Intronic
1100773427 12:97948962-97948984 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101932974 12:109030064-109030086 CAGCGTAACTTGCAGGAAGAAGG - Intronic
1102416960 12:112772201-112772223 TTGGGTGACTTGCCGGAAGAGGG - Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1106612967 13:31301031-31301053 CTGTGAGACTAGAAGCAAGATGG + Intronic
1107271875 13:38628838-38628860 CTCTGTGGCTAACAGGAGGAAGG - Intergenic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108528041 13:51302583-51302605 CTGAGTTACAGGCAGGAAGAAGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109369599 13:61405068-61405090 TTATGAGACTAGCAGAAAGATGG - Intergenic
1110195665 13:72785119-72785141 CAATGTGAGTAGCAGGAAGTTGG - Intronic
1110823438 13:79943570-79943592 CCCTGTGACTAGCATGAAGTGGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113902439 13:113804500-113804522 CAGTGTGACTAGCAGGTGGCGGG + Intronic
1115414085 14:33111205-33111227 CTGCATGGCTAACAGGAAGAAGG - Intronic
1116877518 14:50127476-50127498 TTTTCTGGCTAGCAGGAAGATGG - Intronic
1117349390 14:54866642-54866664 CTGAGTGAGTCACAGGAAGATGG + Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119655093 14:76411602-76411624 CTGTGTGTGTTGCAGGAAGGAGG + Intronic
1121057404 14:90869927-90869949 CAGTCAGACTAACAGGAAGAAGG - Exonic
1122027393 14:98887574-98887596 CTCTGAGTCAAGCAGGAAGATGG + Intergenic
1122482746 14:102058023-102058045 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1124218952 15:27832722-27832744 CTTTGTAACTAGCAAGAAGTAGG - Intronic
1124496376 15:30190072-30190094 GTGTCTGAGTAGCAGGAAGTGGG - Intergenic
1124747199 15:32348576-32348598 GTGTCTGAGTAGCAGGAAGTGGG + Intergenic
1125594984 15:40879108-40879130 ATGTGTGTCTAGCTGGAAGTTGG - Intergenic
1127042071 15:54988075-54988097 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1127899320 15:63329583-63329605 GTGTGTGTCTTGGAGGAAGAAGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128479345 15:68023839-68023861 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1128803974 15:70517137-70517159 CTGTGTGACTTGGAGCAATAAGG + Intergenic
1129663142 15:77564600-77564622 CTGTGGGATTTGCAGCAAGAGGG - Intergenic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1130097940 15:80870166-80870188 CTCAGTGACTAGCAGGACGGTGG - Intronic
1132862944 16:2080403-2080425 GTGGGTGACTGGCAGAAAGATGG - Intronic
1132991339 16:2796696-2796718 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1133467202 16:6039090-6039112 CTGTGTGCATAGCGGGGAGAAGG + Intronic
1133817736 16:9210981-9211003 CTGTGTGCCTGGCATGAAGTAGG + Intergenic
1134192678 16:12134709-12134731 TGGTGTGACTAGCAGGAGGCAGG + Intronic
1135323043 16:21509567-21509589 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1135865719 16:26099978-26100000 CTGTGTGGCTATCTGGAGGAAGG + Intronic
1136334526 16:29602753-29602775 CTGTGTGACTTTCAGCAAGTGGG - Intergenic
1136476962 16:30519536-30519558 CAGTGTGGCTAACAGGCAGAGGG + Intronic
1136554860 16:31001677-31001699 GTGTGTGCATAGCAGGGAGAGGG - Intronic
1137476361 16:48812772-48812794 GTGTGTTACTAGGAGCAAGAGGG + Intergenic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1142941976 17:3387165-3387187 GAGTGTGACTAGCAGGAACCCGG + Intergenic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1146214267 17:30966249-30966271 CTGTGAGGCTAGCAGCAAGATGG + Intergenic
1146596416 17:34173000-34173022 CTGTGAGGCTAGAAGGAAGATGG + Intronic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1146986030 17:37219076-37219098 CTGTGTGATTAGAAGGTTGAGGG + Intronic
1148642381 17:49197769-49197791 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1150982404 17:70157222-70157244 GTGTGTGGATAGCAGGAAGGAGG + Intergenic
1151000613 17:70370955-70370977 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1153831826 18:8930506-8930528 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1153832234 18:8934050-8934072 CTGTGAGGCCAGCAGCAAGATGG + Intergenic
1155483727 18:26317700-26317722 CTGTCTGAATACCAGAAAGAAGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156506438 18:37598322-37598344 CTTTGTAACTATCAGGAAGTGGG - Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1158525223 18:58207267-58207289 CTGTGTGGGGATCAGGAAGAGGG + Intronic
1159752887 18:72324728-72324750 CTGTGTGCAGACCAGGAAGAGGG + Intergenic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162548363 19:11344771-11344793 CTTTGTATCTACCAGGAAGAAGG + Intronic
1162741129 19:12774572-12774594 CTGGGTGATGGGCAGGAAGAGGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163222131 19:15929333-15929355 CTGAGAGAGAAGCAGGAAGAGGG + Intronic
1163431191 19:17268779-17268801 CTGTGTGGCTAGATGGAACACGG - Exonic
1163599602 19:18240948-18240970 CTGTGTGACTCCCAGCAAGCAGG - Intronic
1163704464 19:18804250-18804272 CTGTGTGCGTTGCAGGGAGATGG + Intergenic
1166321050 19:42019103-42019125 GAGTGTGACTCTCAGGAAGAGGG + Intronic
1168510713 19:56971455-56971477 CTGTGTGACTCCCGCGAAGAGGG - Intergenic
925294801 2:2769374-2769396 CTGAGGGACTAGGAGGAAGGAGG - Intergenic
925942035 2:8830066-8830088 CTGTGTGACTCAGAGGGAGATGG - Intronic
928673143 2:33622568-33622590 CTATGTGACTAACAGTGAGATGG + Intergenic
928931194 2:36626103-36626125 CTGTGAGACTAGAAGCAAGATGG + Intronic
930271608 2:49263848-49263870 CAGTGTGCCTAGCAGGATGCTGG - Intergenic
930506938 2:52294307-52294329 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
930699461 2:54444862-54444884 TTGAGTGACTAGAAGGAACAAGG + Intergenic
931021386 2:58047737-58047759 TTGTGTGCCTATCAGGAGGAAGG + Intronic
932576792 2:72966784-72966806 CTGTGGGCCTGGCAGCAAGAAGG - Intronic
933587201 2:84192223-84192245 CTGAGTGCCTAGTAGGAAAAGGG + Intergenic
933844727 2:86315971-86315993 TTGTGTGTCCAGCAGAAAGAAGG - Intronic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
936042205 2:109158554-109158576 CTGTCTGACTTGCAGACAGAGGG + Intronic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
937010578 2:118559383-118559405 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938020945 2:127905428-127905450 CTGTGTGAGGAACAGCAAGAAGG - Intergenic
938059643 2:128242265-128242287 TTGTGTTTCTAGCAGGAGGAGGG + Intronic
938242938 2:129757166-129757188 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938372476 2:130780484-130780506 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
938701944 2:133887422-133887444 CTATGTGCTTAGTAGGAAGAAGG + Intergenic
938754755 2:134369359-134369381 TTGTGAGATTAGCAGGGAGATGG + Intronic
941960116 2:171245222-171245244 CTGTGAGACTAGAAGCAAGATGG - Intergenic
942740700 2:179174274-179174296 CTGTTTGACTAGAAGTAAAAAGG + Intronic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
944237381 2:197452905-197452927 ATGTGGGACACGCAGGAAGAAGG + Intergenic
948127993 2:235578904-235578926 CTGTGTGACTGACAGCTAGAGGG - Intronic
948408325 2:237739743-237739765 CTGAGTGACAAGCAGGATGCAGG - Intronic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1169424394 20:5485034-5485056 GGATGTGACTAGCAGGAACAAGG - Intergenic
1170136106 20:13075288-13075310 ATGTGTCACTAGGAGGGAGAAGG - Intronic
1171398216 20:24854056-24854078 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1172575391 20:36004188-36004210 GTGTGTGACTAGTAGGAGGTGGG + Intronic
1172578810 20:36030732-36030754 CTGTGGGACTTGGAGGAAGGGGG + Intergenic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1177489592 21:21805179-21805201 CTGTGTGACTAGAATAAAGCAGG + Intergenic
1177549429 21:22600644-22600666 CTGTGAGACTACAAGCAAGATGG + Intergenic
1179573895 21:42294799-42294821 AGGTGGAACTAGCAGGAAGATGG - Intronic
1179660730 21:42873187-42873209 CCTTGTGATTAGCAGGAACAAGG - Intronic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1182234730 22:28866358-28866380 CTGAGGGAATAGCAGGATGAGGG + Intergenic
1183717727 22:39543666-39543688 CTTTGAGCCCAGCAGGAAGATGG - Intergenic
1184372894 22:44093927-44093949 GTGAGTGACCTGCAGGAAGAAGG + Exonic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
950296855 3:11839585-11839607 CTGTGAGGCTGGCAGCAAGATGG - Intronic
950659210 3:14456276-14456298 CGCTGTGACCAGCAAGAAGAGGG + Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
952832421 3:37576213-37576235 CTGTGTGCCCAGCTGCAAGAAGG - Intronic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
955683342 3:61525540-61525562 CTGTGTGCCAAGCAGCATGAGGG + Intergenic
956085088 3:65599442-65599464 GTGAGTGACTAGAAGGAAAAGGG - Intronic
956135739 3:66096760-66096782 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
956210854 3:66799767-66799789 CTATGGGGCCAGCAGGAAGAAGG - Intergenic
956279861 3:67544656-67544678 CTGTGAGACTTCTAGGAAGATGG + Intronic
956571078 3:70695837-70695859 ATGTCTGACTAGAAGGCAGAAGG + Intergenic
957525580 3:81374904-81374926 GTAGGTAACTAGCAGGAAGAAGG - Intergenic
958984245 3:100761948-100761970 CTGTTTGAATAACTGGAAGATGG - Intronic
959466877 3:106699214-106699236 AGGTGTGACTAGAAGGGAGATGG + Intergenic
959874739 3:111369312-111369334 TTGTGGGACTTGCAGGAAAAGGG + Intronic
961192092 3:124970527-124970549 CTGAGTGGCAAGCAGGAAGAGGG - Exonic
961264742 3:125632798-125632820 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
961822287 3:129581168-129581190 CTGTGTGAACAGCAGGCAGCAGG - Intronic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
964427970 3:156573113-156573135 CTGTGAGACTAGCAGAAAACAGG - Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
965870723 3:173261238-173261260 CTGTGAGGCTAGAAGTAAGATGG + Intergenic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966986751 3:185187462-185187484 CTGTGTTCCAGGCAGGAAGATGG + Intergenic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
969554955 4:7901212-7901234 GTGCGTGCCTAGCAGGGAGATGG + Intronic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
971975565 4:33681662-33681684 CTGTGAGGCTAGAAGAAAGATGG + Intergenic
973074039 4:45900587-45900609 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973806163 4:54527940-54527962 ATGTGTCACTCCCAGGAAGAGGG - Intergenic
974416078 4:61607940-61607962 CTGTGAGGCTAGAAGCAAGATGG + Intronic
975041900 4:69755437-69755459 CTCTGTGACAAGCAGGACAAAGG + Intronic
975581630 4:75912004-75912026 CTGTGAGGCTAGAAGGAAGATGG + Intergenic
975655230 4:76634801-76634823 TTGTGTGACTTAGAGGAAGAAGG + Intronic
975851054 4:78572965-78572987 CTGTGAGGCTAGAAGCAAGATGG + Intronic
975890954 4:79026900-79026922 TTGTGTGACTAGCAGGTTGTTGG + Intergenic
976772823 4:88672866-88672888 CACTGTGACTAGCAGGCAGATGG - Intronic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
978807786 4:112818588-112818610 CTGTATGATAAGCAGGGAGAGGG + Intronic
979035618 4:115712899-115712921 CTGTCTGCCAGGCAGGAAGATGG + Intergenic
979350902 4:119643452-119643474 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982054024 4:151529566-151529588 CCCTGTGACTAGCAGGTTGATGG + Intronic
982106067 4:152013123-152013145 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
982197140 4:152927995-152928017 CTGAGAGACTTGCAGGATGAGGG - Intergenic
983626328 4:169805291-169805313 CTGTGAGGCTAGAAGCAAGAAGG - Intergenic
985100482 4:186453257-186453279 CTGTGGGGCTAGAAGCAAGATGG + Intronic
985336270 4:188898887-188898909 CTGTGAGACTAGCAGGTAAGAGG - Intergenic
986405860 5:7424380-7424402 CTGTGTGACTTTGAGGAAGTTGG - Intronic
986443527 5:7801277-7801299 CTGTGTGTCTGGCAGGGCGAGGG - Intronic
987733411 5:21806776-21806798 CTGTGAGGCTAGAAGCAAGATGG - Intronic
988217954 5:28301390-28301412 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
988473533 5:31563355-31563377 CTGTGAGGCTAGAAGCAAGACGG - Intergenic
990325545 5:54671880-54671902 CTGTGAGACTAGAAGCAAGATGG - Intergenic
990703629 5:58502306-58502328 CTGTGTATGTAGCAGCAAGAAGG + Intergenic
992959025 5:81940269-81940291 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
995075451 5:107978196-107978218 GTGTGTGGCTAGAAGCAAGATGG - Intronic
996600511 5:125257550-125257572 CTGTGTGTATAGCAGGGAAAGGG - Intergenic
998334051 5:141355303-141355325 GTGTTTGAGGAGCAGGAAGAAGG + Exonic
998480268 5:142457450-142457472 CTGTGTGACTTTGTGGAAGAAGG - Intergenic
998583059 5:143401359-143401381 ATGTGTGACTAGCTGGTAGGAGG - Intronic
999266680 5:150271125-150271147 CTGTGTGACTAGCAGCAGTCTGG - Intronic
1000324071 5:160158745-160158767 CTGTCTGACTGTCATGAAGAGGG + Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001275078 5:170344915-170344937 CTGTGTGACGAGCAACAAGAAGG + Intergenic
1001299190 5:170521882-170521904 CTGAGTGACTACATGGAAGAAGG - Intronic
1002384346 5:178855131-178855153 TTGTGTGTCTGGCAGGGAGAAGG - Intergenic
1002517613 5:179771255-179771277 CTGTGTGACGAGCAGGGACAGGG + Intronic
1004232691 6:13847303-13847325 CTGTGAGATTAGAAGCAAGATGG - Intergenic
1004279922 6:14271929-14271951 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1004425826 6:15506382-15506404 CTGTGTGACTTCCACAAAGAGGG - Intronic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1006034417 6:31200352-31200374 CTGTCTGCCAGGCAGGAAGAGGG + Intronic
1006055119 6:31378472-31378494 CTGTAGGACCAGCAGGAACACGG + Intergenic
1007900137 6:45403763-45403785 ATGTGTGACTTGGGGGAAGAGGG + Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1008178138 6:48293485-48293507 ATGTGTGAATACCAGGAGGAAGG + Intergenic
1008399735 6:51050847-51050869 GTCTGTGACTAGCAGGAGGAAGG + Intergenic
1008499252 6:52164380-52164402 CTTTGTGACAAGGAGGAAGAGGG + Intergenic
1009547605 6:65041295-65041317 TTGTGTGTCTGGCAGGAAGCTGG - Intronic
1011022859 6:82833646-82833668 CTGTGAGACTAGCAGCAAGATGG + Intergenic
1011186147 6:84677735-84677757 CTGAGTGAATAGGAGGAAGGTGG - Intergenic
1011500037 6:87978176-87978198 ATGTGTTACTAGCTGGAATAGGG - Intergenic
1011735167 6:90303192-90303214 CTGTGTGACTAGGAGGGAACTGG + Intergenic
1012248336 6:96952452-96952474 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1012951509 6:105522724-105522746 CTGACTGAGTAGCAGAAAGAGGG + Intergenic
1013067505 6:106698092-106698114 CTGTGAGTCTAGAAGCAAGATGG + Intergenic
1013680709 6:112522411-112522433 CTGTGAGGCTAGAAGGAAGATGG - Intergenic
1014738763 6:125124378-125124400 CTGTGTACCTAGCAGGATTATGG - Intronic
1017039610 6:150297077-150297099 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1020450980 7:8320154-8320176 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1020876054 7:13695260-13695282 CTGTGTGACAAGCTCAAAGAAGG + Intergenic
1021334185 7:19378096-19378118 CTGTCTGACTAGCAGGTTAAAGG + Intergenic
1021420963 7:20444251-20444273 CTGTGAGACTAGAAGCAAGAAGG - Intergenic
1021822982 7:24516457-24516479 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1022819858 7:33948868-33948890 CTGTGAGATAAGCAGGAAGGAGG + Intronic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1023132419 7:37015885-37015907 CTGTGTTACTAGCAGAGAGATGG + Intronic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1024396813 7:48879006-48879028 CTGGGTGAGTAACAGGAAGTAGG - Intergenic
1027161360 7:75804843-75804865 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1029327338 7:99821611-99821633 CTTTTTGACTAGCAGCCAGATGG - Intergenic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1030735519 7:113043429-113043451 AGGTGTGACAAACAGGAAGAAGG + Intergenic
1031325728 7:120394733-120394755 CTGTGAGACTAGAAGTAAGATGG + Intronic
1031405530 7:121381176-121381198 GTCTGTGACTAGGAGGAAGAGGG - Intronic
1031968831 7:128048915-128048937 CCGTGTGAACAGCTGGAAGAAGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033077101 7:138259851-138259873 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1034262030 7:149763257-149763279 GTGTGTGCCCAGCAGGAAGGAGG - Intergenic
1034819739 7:154205819-154205841 CTTTGTGGCTGGCAGTAAGAGGG - Intronic
1035018936 7:155789013-155789035 CGGTGTGGCAAGCAGGGAGAAGG - Intergenic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1037509094 8:19563599-19563621 CTGTGGGAATAGGAGGAAGCAGG - Intronic
1038893671 8:31756325-31756347 CCAGGTGACTAGCAGGAAGCAGG + Intronic
1039047255 8:33461375-33461397 GAGTGTGACAAGCAGAAAGACGG + Exonic
1039190759 8:34971602-34971624 CTGTGTCACTTACAGGAAGAAGG - Intergenic
1039303153 8:36231879-36231901 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1039727306 8:40232736-40232758 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1041055277 8:53979465-53979487 CTGTGACACTAGAAGCAAGATGG - Intronic
1042736585 8:71996228-71996250 CAGCTTGACTAGAAGGAAGATGG - Intronic
1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG + Intronic
1043379969 8:79691997-79692019 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1043603167 8:81965927-81965949 CTGTGTAACTATTTGGAAGAAGG - Intergenic
1043731083 8:83682975-83682997 CAATTTGACTAGCAGGAAGATGG - Intergenic
1044233103 8:89801464-89801486 CTGTGAGACTAGAAGCAAGAGGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044573812 8:93747482-93747504 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1045334357 8:101185554-101185576 GTGTGTCAATAGCAGGAAGAAGG - Intronic
1045734196 8:105276142-105276164 CTGTGAGGCTAGAAGCAAGATGG - Intronic
1045767155 8:105686958-105686980 CTGTGTGCGTAGAAGGAAGAGGG - Intronic
1046045817 8:108963148-108963170 GTGTTTGAAAAGCAGGAAGAAGG - Intergenic
1047413344 8:124642433-124642455 GTGGGTGATTGGCAGGAAGATGG - Intronic
1047677005 8:127213208-127213230 CTGTGTTGCTAACAGGAAGCAGG + Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1050165192 9:2758064-2758086 CTTTGTGATGAGCATGAAGAAGG - Intronic
1050983078 9:12045873-12045895 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1051698233 9:19791233-19791255 CTGTGTTCCAGGCAGGAAGAAGG + Intergenic
1054764300 9:69030356-69030378 CTATGAGACTAGAAGCAAGATGG + Intergenic
1055474008 9:76643522-76643544 GTGTGTCACTTGCAGCAAGATGG + Intronic
1055520899 9:77080161-77080183 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1057969741 9:99543022-99543044 CTTTGTGACTGGGAGGATGATGG - Intergenic
1058438934 9:104990141-104990163 ATTTGTGACTAGCAGGGATAGGG - Intergenic
1058791808 9:108454474-108454496 CTGTGGGACAAGAAGCAAGATGG + Intergenic
1059356107 9:113700705-113700727 CTGTGTGCCAAGAAGAAAGATGG + Intergenic
1059697748 9:116744880-116744902 CTGTGAGACCCACAGGAAGATGG + Intronic
1060652474 9:125340425-125340447 CTGTGTAACTTTGAGGAAGAGGG + Intronic
1060681219 9:125566954-125566976 CTGTGTGACTAGGAGGGATAGGG - Intronic
1186047900 X:5556227-5556249 CTGTGTGGCTAGAAGCAAGCTGG - Intergenic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187112715 X:16318061-16318083 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1187611310 X:20946807-20946829 CTGAGTGAGTAGGAGGAAGGAGG - Intergenic
1187672123 X:21678239-21678261 GGGTGTGACTACCAGGAAGCAGG - Intergenic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1189833489 X:44998290-44998312 CTCTGTGAATAGAAGGAACATGG + Intronic
1192535699 X:71925380-71925402 CTGAGTGACTAACAGAGAGAGGG + Intergenic
1193012007 X:76687253-76687275 CTGTGTGATTAGCTGTGAGATGG + Intergenic
1193493679 X:82183843-82183865 ATGTGTGTATAGCAGGAAAAGGG + Intergenic
1193910541 X:87300935-87300957 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1193998429 X:88395520-88395542 CTGTGTGCCAGGCAGAAAGAAGG + Intergenic
1194418292 X:93639999-93640021 GTGTGGTACTAGCATGAAGAAGG + Intergenic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1197347750 X:125345272-125345294 CTGTGAGGCTAGAAGCAAGAAGG + Intergenic
1197652627 X:129082368-129082390 CTGTGAGGCTAGAAGCAAGATGG + Intergenic
1201642031 Y:16190397-16190419 CTGTGAGGCTAGAAGCAAGATGG - Intergenic
1201660784 Y:16394924-16394946 CTGTGAGGCTAGAAGCAAGATGG + Intergenic