ID: 973323236

View in Genome Browser
Species Human (GRCh38)
Location 4:48831224-48831246
Sequence CAGTCGCCTGCTGCTGTCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973323233_973323236 0 Left 973323233 4:48831201-48831223 CCCTGATCGCTTGGTTTTCCTTG 0: 1
1: 0
2: 0
3: 7
4: 137
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323231_973323236 8 Left 973323231 4:48831193-48831215 CCTTCTGCCCCTGATCGCTTGGT 0: 1
1: 0
2: 1
3: 3
4: 116
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323232_973323236 1 Left 973323232 4:48831200-48831222 CCCCTGATCGCTTGGTTTTCCTT 0: 1
1: 0
2: 1
3: 15
4: 146
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323234_973323236 -1 Left 973323234 4:48831202-48831224 CCTGATCGCTTGGTTTTCCTTGC 0: 1
1: 0
2: 0
3: 2
4: 83
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323229_973323236 13 Left 973323229 4:48831188-48831210 CCGGGCCTTCTGCCCCTGATCGC 0: 1
1: 0
2: 1
3: 15
4: 147
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323225_973323236 30 Left 973323225 4:48831171-48831193 CCTCTCGAGTCCACCCTCCGGGC 0: 1
1: 0
2: 0
3: 6
4: 91
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323228_973323236 16 Left 973323228 4:48831185-48831207 CCTCCGGGCCTTCTGCCCCTGAT 0: 1
1: 2
2: 0
3: 18
4: 210
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323227_973323236 17 Left 973323227 4:48831184-48831206 CCCTCCGGGCCTTCTGCCCCTGA 0: 1
1: 0
2: 2
3: 13
4: 207
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83
973323226_973323236 20 Left 973323226 4:48831181-48831203 CCACCCTCCGGGCCTTCTGCCCC 0: 1
1: 0
2: 6
3: 33
4: 826
Right 973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973323236 Original CRISPR CAGTCGCCTGCTGCTGTCGT CGG Exonic
901514209 1:9734255-9734277 CTCTCGCTTGCTTCTGTCGTTGG - Intronic
902452545 1:16506463-16506485 CAGTCCCCTACTACTGTTGTGGG + Intergenic
902472603 1:16659125-16659147 CAGTCCCCTACTACTGTTGTGGG + Intergenic
902486201 1:16748318-16748340 CAGTCCCCTACTACTGTTGTGGG - Intronic
902500197 1:16905849-16905871 CAGTCCCCTACTACTGTTGTGGG - Intronic
903172734 1:21563884-21563906 CAGACACCTGCTGCTGTGGATGG + Intronic
905175700 1:36134139-36134161 CAGTGGCCGGCGGCTGTCCTGGG + Intergenic
910138422 1:83999177-83999199 CATTCGCCTGCTGCGGCCGGGGG + Intergenic
910549717 1:88462628-88462650 CCGCCGCCTGCTGCAGTCCTCGG - Intergenic
913110244 1:115651036-115651058 CATTTTCCTGCTGCTGTGGTAGG + Intronic
914517358 1:148385294-148385316 CAGTCCCCTACTACTGTTGTGGG + Intergenic
916279050 1:163028440-163028462 CAGTGACCAGCAGCTGTCGTAGG - Intergenic
918044914 1:180935828-180935850 CAGTCGCGGGCTGCTGCCTTGGG - Exonic
919929172 1:202210038-202210060 CAGAAGCCTGCTGCTCTGGTGGG + Intronic
923405773 1:233657850-233657872 CAGTCACCTTCTGCTGTAGGAGG - Intronic
1062892382 10:1073903-1073925 CAGTCGCATGCTGAGGTCCTGGG + Intronic
1067786629 10:49255005-49255027 CAGTCGCCTGCTGGAGTAGGGGG - Intergenic
1069462027 10:68604586-68604608 CAGTCTCCTGCTGCTTTGATTGG + Intronic
1071639038 10:87287414-87287436 CACTCTCCTTCTGCTGTCTTGGG - Intergenic
1071656200 10:87450536-87450558 CACTCTCCTTCTGCTGTCTTGGG + Intergenic
1072484012 10:95837263-95837285 CTGTCGTATGCTGCTGTGGTTGG + Intronic
1073595350 10:104794086-104794108 CAGGCGGCTGCTGTTGTCTTTGG + Intronic
1077113270 11:871347-871369 GAGGGGCCTGCTGCTGTCCTGGG - Intronic
1077290188 11:1785736-1785758 CCGTCGCCTAGTGCCGTCGTAGG + Intergenic
1080360698 11:31509900-31509922 CAGTCGAGGGCCGCTGTCGTTGG - Exonic
1082797191 11:57386879-57386901 CAGTGGCCTGCTGTGGTAGTTGG - Exonic
1088577058 11:111282712-111282734 AAGTGGTCTGCTGCTGTGGTTGG + Intronic
1105067935 12:133216585-133216607 CAGTCTCCTGGTGCTGTTTTAGG + Intergenic
1110871312 13:80455437-80455459 CAGGCACCTGCTGCTGTGCTGGG - Intergenic
1112041751 13:95553713-95553735 CCGGTGCCTGCTGCTGTCCTGGG + Intronic
1112462331 13:99613954-99613976 CAGTCGCCTGGGACTGTCCTGGG + Intronic
1113201726 13:107873944-107873966 CAGCAGCTTGCAGCTGTCGTGGG + Intergenic
1120979321 14:90276813-90276835 GAGGCGCCAGCTGCTGTCATGGG + Exonic
1127810567 15:62561709-62561731 TGATCGCCTGCTGCTGTCCTTGG + Intronic
1129074023 15:72976103-72976125 CATTACCCTGCTGCTGTTGTGGG - Intergenic
1132633253 16:929940-929962 GAGGCGACTGCTGCTGTCCTGGG - Intronic
1132633336 16:930292-930314 AGCTCGCCTGCTGCTGTCCTGGG - Intronic
1136737117 16:32475349-32475371 CAGCCGCCTGCTGCTGCCGCCGG + Intergenic
1137576931 16:49606261-49606283 CAGGCCCCTTCTGCTGTCGGTGG - Intronic
1137815191 16:51392038-51392060 CAGTCGCCTGTTGCTGTCAGCGG + Intergenic
1203015954 16_KI270728v1_random:354228-354250 CAGCCGCCTGCTGCTGCCGCCGG - Intergenic
1203034289 16_KI270728v1_random:627386-627408 CAGCCGCCTGCTGCTGCCGCCGG - Intergenic
1147591134 17:41684028-41684050 CTGTCCCCTGCTGCTCTCGGAGG + Intergenic
1151589173 17:75032326-75032348 CAGTCTCCTCGTTCTGTCGTGGG - Intergenic
1152706597 17:81846754-81846776 CAGTCACCTGCTGGTCTGGTTGG - Intronic
1152790061 17:82273863-82273885 CAGGCTCCTGCTGCTCTCGCGGG + Intergenic
1157750157 18:50171267-50171289 CATGCCTCTGCTGCTGTCGTTGG - Intronic
1159041280 18:63325119-63325141 CAGATGCCTACTGCTCTCGTTGG + Intergenic
1165051565 19:33144917-33144939 AGGTCACCTGCTGCTGTCGCCGG - Exonic
1166739673 19:45106194-45106216 CAGGCTCCTGCTGCTCTCCTCGG + Intronic
1202704994 1_KI270713v1_random:15943-15965 CAGTCCCCTACTACTGTTGTGGG + Intergenic
925171666 2:1754031-1754053 CACTCCCCTGCTGCCGTCGTGGG - Intergenic
930946678 2:57084380-57084402 CAGTCTCCTGCTGCTGTTCATGG + Intergenic
931470185 2:62531752-62531774 CTGTGGCCTGCTGCAGTGGTTGG + Intergenic
932459756 2:71874656-71874678 CAGGCCCCTGCTGCAGTCCTGGG - Intergenic
932715100 2:74094967-74094989 CACTCCCCTGCTGATGGCGTCGG - Intronic
933725322 2:85423735-85423757 CCCTCGCCTGCTGCTGTCACAGG - Intronic
934993431 2:98936652-98936674 CAGTGGCCTGCGGCGGGCGTGGG + Intergenic
939848735 2:147279019-147279041 CAGTCACCTGCTACTGTGATTGG - Intergenic
948136774 2:235642443-235642465 CAGAGGGCTGCTGCTGTGGTGGG - Intronic
1171194418 20:23186390-23186412 CAGTGGCCTCCTGCTGTGGTGGG - Intergenic
1176952772 21:15065368-15065390 CAGGCGCCTGCAGCGGTCGCGGG - Intergenic
1179124267 21:38577556-38577578 CAGGCTCCTGGTGCTCTCGTGGG + Intronic
1180971548 22:19818766-19818788 CACGGGCCTGCTGCTGTCCTGGG - Intronic
1181672193 22:24430890-24430912 CAGTCGCCTGTTGCTGCTGCTGG + Intronic
952243784 3:31562747-31562769 CAGTCGCCCTCTGCTGGGGTGGG + Intronic
958101407 3:89016101-89016123 CAGTCACCTGCTGCTCTTCTAGG + Intergenic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
969071367 4:4541999-4542021 CGGTCGCCGGCTGCTTACGTGGG - Exonic
969220531 4:5755798-5755820 CAGTCTCCTGCTGCTCTGCTGGG + Intronic
973323236 4:48831224-48831246 CAGTCGCCTGCTGCTGTCGTCGG + Exonic
997642863 5:135460883-135460905 CAGCCCCATGCTGCTGTCCTTGG - Intergenic
1002445418 5:179287401-179287423 GAGTGGCCTGCTGCTGGCGGAGG - Intronic
1004192569 6:13477041-13477063 CAGAGGCCTGCTGCTCTCCTAGG + Intronic
1005993016 6:30914986-30915008 GAGTCGCCTGCTTCTCTCGCAGG - Exonic
1013003314 6:106046544-106046566 CAGTCCCCTGTTGCAGTCATTGG + Intergenic
1016570447 6:145506749-145506771 CAGTCTCCAGCTGCAGTCCTTGG + Intronic
1019711441 7:2519879-2519901 CCGGCGCCTGCTGCTGGCGCTGG + Exonic
1023686159 7:42737585-42737607 CAGTCCCCTGCTGTTGTCATGGG - Intergenic
1024991433 7:55237545-55237567 CAATCGCCTGCACCTGTCCTGGG + Intronic
1030183256 7:106732573-106732595 CAATTGCTTGCTGCTGTCGTTGG + Intergenic
1033195237 7:139321800-139321822 CCCTGGCCTGCTGCTGTCCTGGG - Intergenic
1035209081 7:157314384-157314406 CATCCTCCTGCTGCTTTCGTGGG + Intergenic
1052638680 9:31135708-31135730 CAGTACTCTGCTGCTCTCGTTGG + Intergenic
1055657124 9:78462188-78462210 CACTTTCCTGCTGCTGTCATTGG - Intergenic
1061741180 9:132707704-132707726 CAGTCCCCACCTGCTGTCATTGG + Intergenic
1061953294 9:133948467-133948489 CAGTCGCCTGCCCCTGACCTGGG - Intronic
1062431076 9:136527118-136527140 CAGTCTCCCGCTGCTGCTGTGGG + Intronic
1190632307 X:52399819-52399841 CTGTGGGCTGCTGCTGTTGTTGG + Intergenic
1194435824 X:93867947-93867969 CAGTCTCCAGCTGCTGTCACTGG - Intergenic
1198870848 X:141176375-141176397 CAGTTACCTGCTGCTGGGGTCGG - Exonic
1200775487 Y:7166810-7166832 TAGTCTCCTGCTCCTGTCTTTGG + Intergenic