ID: 973327548

View in Genome Browser
Species Human (GRCh38)
Location 4:48878632-48878654
Sequence TGTGCCATGCAGATGGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973327542_973327548 6 Left 973327542 4:48878603-48878625 CCCTCTCCCAAGCACACAGATTT No data
Right 973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG No data
973327543_973327548 5 Left 973327543 4:48878604-48878626 CCTCTCCCAAGCACACAGATTTT No data
Right 973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG No data
973327544_973327548 0 Left 973327544 4:48878609-48878631 CCCAAGCACACAGATTTTCTCTC No data
Right 973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG No data
973327545_973327548 -1 Left 973327545 4:48878610-48878632 CCAAGCACACAGATTTTCTCTCT No data
Right 973327548 4:48878632-48878654 TGTGCCATGCAGATGGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973327548 Original CRISPR TGTGCCATGCAGATGGTTCA GGG Intergenic
No off target data available for this crispr