ID: 973333506

View in Genome Browser
Species Human (GRCh38)
Location 4:48933395-48933417
Sequence GTGAACAAATCGAAGCTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973333506_973333511 -1 Left 973333506 4:48933395-48933417 CCAGCAAGCTTCGATTTGTTCAC No data
Right 973333511 4:48933417-48933439 CCGGCTCCAGGGCTGATTAGTGG No data
973333506_973333513 10 Left 973333506 4:48933395-48933417 CCAGCAAGCTTCGATTTGTTCAC No data
Right 973333513 4:48933428-48933450 GCTGATTAGTGGCTTTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973333506 Original CRISPR GTGAACAAATCGAAGCTTGC TGG (reversed) Intergenic
No off target data available for this crispr