ID: 973336288

View in Genome Browser
Species Human (GRCh38)
Location 4:48959740-48959762
Sequence CTGCATTCATTGTACAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973336288_973336289 -6 Left 973336288 4:48959740-48959762 CCAGTCTTGTACAATGAATGCAG No data
Right 973336289 4:48959757-48959779 ATGCAGTTGTCTTAGCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973336288 Original CRISPR CTGCATTCATTGTACAAGAC TGG (reversed) Intergenic
No off target data available for this crispr