ID: 973336862

View in Genome Browser
Species Human (GRCh38)
Location 4:48965468-48965490
Sequence AGGACTGGTGTATCTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973336859_973336862 12 Left 973336859 4:48965433-48965455 CCTTGGGTAAATCACATACTAAT No data
Right 973336862 4:48965468-48965490 AGGACTGGTGTATCTACCCAAGG No data
973336858_973336862 27 Left 973336858 4:48965418-48965440 CCTGGAATAACTTGACCTTGGGT No data
Right 973336862 4:48965468-48965490 AGGACTGGTGTATCTACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973336862 Original CRISPR AGGACTGGTGTATCTACCCA AGG Intergenic
No off target data available for this crispr