ID: 973339097

View in Genome Browser
Species Human (GRCh38)
Location 4:48986181-48986203
Sequence TGCCAGAGCCTGGCCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 0, 2: 2, 3: 78, 4: 683}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973339097_973339108 5 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339108 4:48986209-48986231 GGCTGGGTGTGGTCGTGAAGGGG 0: 1
1: 0
2: 1
3: 17
4: 268
973339097_973339107 4 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339107 4:48986208-48986230 AGGCTGGGTGTGGTCGTGAAGGG 0: 1
1: 0
2: 4
3: 34
4: 298
973339097_973339105 -6 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339105 4:48986198-48986220 CTGGCAGGCGAGGCTGGGTGTGG 0: 1
1: 0
2: 7
3: 82
4: 707
973339097_973339109 8 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339109 4:48986212-48986234 TGGGTGTGGTCGTGAAGGGGCGG 0: 1
1: 0
2: 1
3: 31
4: 444
973339097_973339111 12 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339111 4:48986216-48986238 TGTGGTCGTGAAGGGGCGGGCGG 0: 1
1: 0
2: 0
3: 11
4: 262
973339097_973339110 9 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339110 4:48986213-48986235 GGGTGTGGTCGTGAAGGGGCGGG 0: 1
1: 0
2: 1
3: 31
4: 353
973339097_973339106 3 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339106 4:48986207-48986229 GAGGCTGGGTGTGGTCGTGAAGG 0: 1
1: 1
2: 3
3: 43
4: 589
973339097_973339112 17 Left 973339097 4:48986181-48986203 CCCGGCCTGGCCAGGCTCTGGCA 0: 1
1: 0
2: 2
3: 78
4: 683
Right 973339112 4:48986221-48986243 TCGTGAAGGGGCGGGCGGACCGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973339097 Original CRISPR TGCCAGAGCCTGGCCAGGCC GGG (reversed) Intergenic
900003473 1:29044-29066 TGCTAGGGCCGGGCAAGGCCGGG + Intergenic
900023193 1:199560-199582 TGCTAGGGCCGGGCAAGGCCGGG + Intergenic
900090107 1:916553-916575 CCCCAGAGCCTGCTCAGGCCTGG - Intergenic
900094067 1:933302-933324 CGACACAGCCTGGCCTGGCCCGG - Intronic
900130827 1:1086460-1086482 TGCCTGGGCCAGGACAGGCCAGG + Intronic
900189681 1:1348121-1348143 TGGCTGGGCCGGGCCAGGCCAGG + Intronic
900341291 1:2190538-2190560 GGCCACACCTTGGCCAGGCCTGG - Intronic
900405269 1:2490209-2490231 TGCCAGGGCCTGGGTGGGCCAGG - Intronic
900474408 1:2869477-2869499 TCCCAGAGCCTGGCCTGGCACGG + Intergenic
900512259 1:3066350-3066372 GGGCAGGGCCTGGCCAGGCCAGG + Intergenic
900796150 1:4709450-4709472 TGGCAGAGTCTGGTGAGGCCTGG + Intronic
900923026 1:5685637-5685659 GCCCAGTGCCTGGCCCGGCCCGG - Intergenic
901185619 1:7371199-7371221 TGCCACATCCAGGCCAGGCACGG - Intronic
901217118 1:7561125-7561147 GGCCAGCCCCTGGCCATGCCTGG - Intronic
901262707 1:7885617-7885639 TGCCAGACCCCGCCCAGCCCTGG - Intergenic
901297267 1:8170228-8170250 GGCCAGGGCATGGCCAGGGCAGG + Intergenic
901456035 1:9363406-9363428 TGCCACAGCCTGGCCATCTCTGG - Intronic
901459846 1:9384975-9384997 TGCCAGAGCCTGGGAGGGGCCGG + Intergenic
901608589 1:10478660-10478682 TGCCTGAGCCTGGGCGGGCAAGG - Intronic
902288447 1:15421573-15421595 AGCCACAGCCCAGCCAGGCCTGG + Intronic
902328272 1:15716960-15716982 TGCCAGCACCAGGCCAGGCATGG + Intronic
902375272 1:16027451-16027473 TGCCTGACCCTGGCCCTGCCTGG + Intronic
902380234 1:16049261-16049283 TGCCTGACCCTGGCCCTGCCTGG + Intronic
902387779 1:16085629-16085651 TTCCAGGGCCTGGCTGGGCCAGG + Intergenic
902398636 1:16145565-16145587 TGCCGGACCCTCCCCAGGCCTGG - Intronic
902586798 1:17444387-17444409 CGCCAGAGCCTGGGAAGTCCAGG + Intergenic
902615329 1:17620572-17620594 GGCCAGGCCATGGCCAGGCCTGG + Intronic
902663213 1:17919974-17919996 TGCCAGAGCCTGGCAAGTCTTGG - Intergenic
903320869 1:22542536-22542558 TGACAGAGCCATGCCAGGGCCGG + Intergenic
903365808 1:22804938-22804960 TGCCTGTGCCTGGACATGCCAGG + Intronic
903499091 1:23791964-23791986 TCCCAGAGCGTGGTCAAGCCAGG + Intronic
903738239 1:25543806-25543828 TGCCCGATCCCGGCCCGGCCCGG - Intronic
903887037 1:26546596-26546618 TGACTCAGCCTGGCCATGCCTGG + Intronic
904007497 1:27371173-27371195 TGCCACAGCCTTGCAAGCCCTGG + Intronic
904023786 1:27489713-27489735 TGGCAGAACCAGGTCAGGCCGGG + Intronic
904025307 1:27499111-27499133 TGCACAAGCCTGGCCAGGGCAGG - Intergenic
904042905 1:27594416-27594438 TGCCAGAGCCAGGGCAGGGCTGG + Intronic
904299636 1:29546031-29546053 TTCCAGGGCCAGGCCTGGCCAGG - Intergenic
904439139 1:30518432-30518454 TGTCTCAGCCTGGCCAGGGCTGG + Intergenic
904643341 1:31947049-31947071 TACCAGATCCTGGCCAAGCATGG + Intergenic
904865397 1:33574987-33575009 TACAAGAGCAAGGCCAGGCCAGG - Intronic
905013230 1:34760771-34760793 TGCCAGGGCTGGGCCAGGGCAGG - Intronic
905542824 1:38773814-38773836 GGCCAGAGTCTGTGCAGGCCGGG + Intergenic
905644918 1:39618507-39618529 TGGCAAAGCTTGGCCAGGCATGG - Intergenic
905936636 1:41829095-41829117 TGTGAGTGCCTGGCCTGGCCAGG - Intronic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
907526292 1:55056094-55056116 TGCCAGCGCCTGGCGAGGGCTGG + Exonic
908085313 1:60625797-60625819 TCCCAGCCCCTGGCCTGGCCTGG + Intergenic
908085319 1:60625805-60625827 AGCCTCAGCCAGGCCAGGCCAGG - Intergenic
913958432 1:143322484-143322506 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
914052749 1:144147864-144147886 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
914126448 1:144818677-144818699 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
915282143 1:154829841-154829863 TTCCCGAGGCTGGCCATGCCTGG + Intronic
915742880 1:158132758-158132780 AGCCAGAGCCTAGAGAGGCCAGG - Intergenic
915916069 1:159941750-159941772 TGCCTCCGCCTGCCCAGGCCTGG - Intronic
917198965 1:172495759-172495781 TGCCATAGACTGGCTAAGCCTGG - Intergenic
917482505 1:175424316-175424338 CACCACTGCCTGGCCAGGCCAGG - Intronic
917495190 1:175534165-175534187 TGGCTGAGGCTGGCCATGCCTGG + Intronic
918142774 1:181732730-181732752 TGACAGGGCCTGGCCAGCCATGG - Exonic
919262741 1:195218623-195218645 GGGCAGGGCCGGGCCAGGCCGGG + Intergenic
920033284 1:203049777-203049799 CGCCAGAGGCTGGGCATGCCAGG + Intronic
920336721 1:205249850-205249872 TGCCAGTGGCTCGCCAGGCCAGG + Intronic
920647564 1:207814617-207814639 GGCTAGAGTCTGGCCAGCCCTGG - Intergenic
920722716 1:208402558-208402580 TCTCAGAGCCTGGACAGGCCTGG - Intergenic
922464604 1:225838589-225838611 TGCCAGAGCCTGACCGTGCAGGG + Intronic
922753298 1:228081245-228081267 TGGCAGAGCGTGGCCAGGGGTGG - Intergenic
923235673 1:232030821-232030843 ATCCAGAGCCTGGCCAGGTGCGG + Intronic
1063048446 10:2418263-2418285 TGCCAGAGCCTGGGAAGGGGAGG - Intergenic
1063664193 10:8051820-8051842 GGCCGGCGCCTGGCCTGGCCCGG + Intergenic
1063976758 10:11423656-11423678 TGCCGGAGGCAGGCCAGGACAGG + Intergenic
1064030534 10:11880161-11880183 TCCCCGAGGCTGGGCAGGCCTGG + Intergenic
1064262294 10:13795797-13795819 AGCCAGAGGCTGGGCAGGTCAGG - Intronic
1064340210 10:14478679-14478701 TGCCAGAGCCTCAGCAGGGCAGG + Intergenic
1065984749 10:30938564-30938586 TGCTAGAGCTAGGCCAGGCATGG - Intronic
1066217323 10:33300460-33300482 TGCCTGATTCTGTCCAGGCCGGG - Intronic
1067029502 10:42870918-42870940 TGGCAGAGCCAGGGCCGGCCTGG + Intergenic
1067557412 10:47282565-47282587 GGACAGAGCTTGGCCAGGCAGGG + Intergenic
1067684295 10:48457706-48457728 TGCTAAAGCCTCACCAGGCCTGG - Intronic
1067803614 10:49377463-49377485 TGCCTGAGTCTGGGCTGGCCCGG + Intronic
1067924809 10:50497500-50497522 TACCAGATCCTGGCCGGGCGCGG + Intronic
1069419871 10:68237716-68237738 TGTCAGAGACTGGCCAGGCGCGG + Intergenic
1070398398 10:76032301-76032323 TGCCAGCCACTGGCCTGGCCTGG + Intronic
1070669518 10:78368270-78368292 TGACAGAGTCTGCCCAGGCTGGG + Intergenic
1070746068 10:78934772-78934794 TCCGTGAGCCTGGCCAGCCCTGG + Intergenic
1070801645 10:79247484-79247506 TTCCTGAGCCTGGCCAGGCAGGG - Intronic
1070844774 10:79513176-79513198 GGCCAGAGCCAGGCCAGGCTGGG - Exonic
1070929030 10:80247135-80247157 GGCCAGAGCCAGGCCAGGCTGGG + Intergenic
1071512229 10:86269290-86269312 TGCTGGAGCCTGCCCAGTCCAGG - Intronic
1073036169 10:100565485-100565507 TGCCAGAGCCTGGCCCAGGAGGG + Intergenic
1073193863 10:101672224-101672246 AGCCAGGGCCTGCACAGGCCTGG - Intronic
1073363351 10:102917918-102917940 TCCCGGAGCCTGGACCGGCCAGG - Intergenic
1073398475 10:103237864-103237886 AGACAGGGCCTGGCCGGGCCTGG - Intergenic
1074314020 10:112345768-112345790 GGCCAGAGCCTGCCCAGACCAGG - Intergenic
1074445728 10:113519787-113519809 AGCCAGAGCCTGGGCATGCTGGG - Intergenic
1075016732 10:118915172-118915194 TGCCACTGCCTGCCCAGGGCAGG + Intergenic
1075390399 10:122087102-122087124 TGGGGCAGCCTGGCCAGGCCTGG + Exonic
1075647088 10:124103783-124103805 TGATAGAGCCTGGCCTGGCTTGG - Intergenic
1075651064 10:124128588-124128610 CACCAGAGCCTGGCCAGGTGAGG - Intergenic
1075729057 10:124625583-124625605 CGCCTGCCCCTGGCCAGGCCTGG + Intronic
1075742339 10:124703536-124703558 CGTCAGTGCCTGGCCCGGCCTGG - Intronic
1075745348 10:124723718-124723740 AGGCAGAGCCTGGACAGCCCAGG + Intronic
1075872012 10:125777974-125777996 TGCCAGGGCTGGGCCAGGCGAGG - Intergenic
1076554108 10:131311213-131311235 GGCCAGAGCCGGGCCGGGCAGGG + Intronic
1076718900 10:132384066-132384088 GGCCTCAGCCTGGGCAGGCCGGG + Intergenic
1076777445 10:132705544-132705566 TCCAAGTGCGTGGCCAGGCCGGG + Intronic
1077036499 11:497992-498014 TGCCAGGGCCTGGGCCAGCCTGG - Exonic
1077136194 11:1000371-1000393 TGCCTGGGGTTGGCCAGGCCAGG + Intronic
1077368386 11:2170501-2170523 TCCCAGAGCCGTCCCAGGCCTGG + Intronic
1077408894 11:2394511-2394533 ATCCAGGGCCTGGCCAGTCCAGG + Intronic
1078182815 11:9026995-9027017 TGACCGAGCCTGGCCAGGTGGGG - Intronic
1078924752 11:15864620-15864642 GGGAAGAGCCAGGCCAGGCCAGG + Intergenic
1078938448 11:15973837-15973859 TCCCAGAGGGTGGCAAGGCCTGG + Intronic
1079081397 11:17415754-17415776 GGACAGAGCCAGGCCAGGCCAGG + Intronic
1079244551 11:18743057-18743079 TCCCAGAGTCAAGCCAGGCCTGG + Exonic
1079279169 11:19072610-19072632 TGCCAGTGTTTGGCCAGGGCGGG + Intergenic
1079452151 11:20606506-20606528 TGGCAGAGCCTGCCCAACCCTGG + Intronic
1080456834 11:32426794-32426816 TGCGAGAGCCAGGCCAGCCCCGG + Intronic
1081852737 11:46285091-46285113 TGCAGTAGCCAGGCCAGGCCAGG - Intronic
1082004150 11:47410418-47410440 TCCCACACCCTGGCCAGCCCTGG - Intronic
1083417475 11:62535045-62535067 CTCCCGAGCCTGGCCAGACCTGG - Exonic
1084009682 11:66340612-66340634 TGCCAGGCCCTTTCCAGGCCTGG + Intronic
1084095054 11:66905838-66905860 CGCCAGGGCCTGGGCAGCCCAGG - Intronic
1084306930 11:68291941-68291963 AGACAGACCTTGGCCAGGCCAGG + Intergenic
1084573280 11:69972862-69972884 TGCCAGATAGGGGCCAGGCCAGG - Intergenic
1085391661 11:76185296-76185318 CCCCAGTGCCTGGCCAGGGCAGG - Intergenic
1085413691 11:76306643-76306665 CCCCAGGGCCAGGCCAGGCCTGG - Intergenic
1085534157 11:77208129-77208151 TGCCAGAGAATGTCCAAGCCAGG + Intronic
1086187273 11:84033746-84033768 TGCCACAGCCGGGCCGGGCGCGG + Intronic
1086324062 11:85680829-85680851 TGCCAGAGCCTTATCAGGCAGGG - Intronic
1086449949 11:86906136-86906158 GGCCAGGGCCTGGCGGGGCCGGG + Intronic
1086921575 11:92593809-92593831 TTCCATTGCCTGGCTAGGCCAGG + Intronic
1087442792 11:98207678-98207700 TGGCAGGGCCTGGACAGCCCAGG - Intergenic
1088417902 11:109609644-109609666 TTCCAGACCCTGCCCATGCCAGG - Intergenic
1088773927 11:113063363-113063385 TGCCACTGCCTAGCCTGGCCTGG + Intronic
1089566592 11:119375065-119375087 GGCCAGAGGCTGGCCAGGCTGGG - Intronic
1089752548 11:120661644-120661666 AGCCAAAACCTGGCTAGGCCAGG + Intronic
1090297434 11:125601328-125601350 AGCCAGAATCTGGCCAGGCATGG + Intronic
1090465671 11:126930933-126930955 TGCCATAGCCTGGCAAATCCAGG - Intronic
1090629445 11:128633448-128633470 TGCCAGAGCCTGCTGTGGCCAGG - Intergenic
1091376892 12:31098-31120 TGCTAGGGCCGGGCAAGGCCGGG + Intergenic
1091752423 12:3031243-3031265 GGGCTGAGCCTGGACAGGCCGGG - Intronic
1091826962 12:3520075-3520097 TCCCAGAGCCAGGCTGGGCCAGG + Intronic
1091857693 12:3752819-3752841 AGCAAGGGCCAGGCCAGGCCTGG + Intronic
1092114406 12:5988718-5988740 CTGCATAGCCTGGCCAGGCCTGG - Intronic
1092354232 12:7781557-7781579 TGGCAGAACTTGGCCAGGCATGG + Intergenic
1092907038 12:13110623-13110645 TTCCAGAGCCTGGATAGGGCAGG + Intronic
1093994369 12:25625726-25625748 TGCCAGAGCCCTGCCTGGCTGGG + Intronic
1095367452 12:41424867-41424889 TGCAAGAGCATTGTCAGGCCTGG - Intronic
1096154090 12:49332263-49332285 TGCCAGAGGCAGGCCTTGCCTGG + Intergenic
1096227162 12:49873549-49873571 TCCCAGAGCCTGGTCACCCCTGG + Intronic
1097846594 12:64372803-64372825 TAGTAGAGCCTGGCCAGGCATGG - Intronic
1098024629 12:66189091-66189113 TGCGTCCGCCTGGCCAGGCCTGG - Exonic
1100404953 12:94264500-94264522 TGCCCGGGCCGGGCCTGGCCTGG + Intronic
1101422717 12:104562727-104562749 TACCGGACCCTGGGCAGGCCCGG - Intronic
1101968594 12:109296931-109296953 TGCAAGAGCCTGATCAGGCAGGG + Intronic
1102246940 12:111362026-111362048 TGCCTCAGCCAGCCCAGGCCAGG + Exonic
1102569855 12:113820814-113820836 TGCCAATTCCAGGCCAGGCCTGG + Intronic
1103745610 12:123121145-123121167 GGTGAGAGCTTGGCCAGGCCTGG - Intronic
1103922080 12:124404311-124404333 GGCCAGAGTCTGGGCAGGGCCGG + Intronic
1103963683 12:124624855-124624877 TGGCAGAGCCGGGCAGGGCCGGG - Intergenic
1103994067 12:124817785-124817807 TGCCCGAGCCCGGCCAGGGAAGG + Intronic
1104568160 12:129903492-129903514 CGCCAGTCCATGGCCAGGCCGGG + Exonic
1104974959 12:132548215-132548237 TGGAAGAGCCTGTCCAGGGCTGG + Intronic
1105014096 12:132775702-132775724 ATCCAAAACCTGGCCAGGCCTGG - Intronic
1105252266 13:18709891-18709913 TCCAAAAGCCTGGCCAGGCGCGG - Intergenic
1105422698 13:20266865-20266887 TGCTGGAAGCTGGCCAGGCCTGG - Intergenic
1105790519 13:23793747-23793769 TAACAGAGGCTGGCCAGGTCTGG + Intronic
1106178340 13:27350246-27350268 AGCCAGTGCCTGGCCAGGGAAGG - Intergenic
1106393188 13:29355542-29355564 TGTAGGAGCCTGGCCAGGCCTGG - Intronic
1107036265 13:35905653-35905675 TGCCAGAGCCAGGCCAGGTGTGG + Intronic
1107682354 13:42865033-42865055 TGCCAGAGGCTGGGAAGGGCTGG + Intergenic
1107696776 13:43008011-43008033 TTCCAGAGACCGGCCAGGCGTGG - Intergenic
1108191469 13:47944830-47944852 TTCAAGAGTCTGGCCAAGCCTGG + Intronic
1109257792 13:60104799-60104821 TGCCAGTGATTGGCCAGGCGCGG + Intronic
1110690925 13:78429092-78429114 TCCCAGAGCCGGGCTGGGCCGGG - Intergenic
1110823019 13:79938128-79938150 AGCAAGAGCCTGGCCTGGTCTGG + Intergenic
1111993372 13:95138840-95138862 TGTGAGGGCCTGCCCAGGCCAGG - Intronic
1112014804 13:95322812-95322834 AGCCAGACCTTGGCCAGGCATGG - Intergenic
1112216027 13:97433072-97433094 TCCCAGTGCCTTGCCAGGCGGGG - Intergenic
1112279685 13:98051688-98051710 TGCCACAGCCGGGCCAGGCACGG + Intergenic
1113653959 13:112056856-112056878 TGCCGGAGCCGGGCCGGACCGGG + Intergenic
1113661354 13:112108237-112108259 TGCCAGCCCCTGGCTGGGCCTGG + Intergenic
1113855910 13:113445417-113445439 TGCCACAGCCTGTCCTGGCATGG - Intronic
1113866400 13:113528525-113528547 GGCCAGAGCATGGCCAAGCTGGG - Intronic
1113930912 13:113968384-113968406 TGCCGGAGCCTGGACCTGCCCGG - Intergenic
1114271793 14:21104605-21104627 TGCCTGGCCCTGGCTAGGCCGGG - Intronic
1114455581 14:22851264-22851286 TGCCAGTGACTGCCCTGGCCAGG - Intergenic
1115310484 14:31974101-31974123 TGGCAGGGCCAGGCCAGTCCAGG - Intergenic
1115817121 14:37175677-37175699 AAACATAGCCTGGCCAGGCCTGG - Intergenic
1117769419 14:59118088-59118110 TGCCAGAGCCAGTCCATGGCTGG - Intergenic
1118421301 14:65607771-65607793 TGCTAGAACCTGGCCAGGCACGG + Intronic
1118688357 14:68313953-68313975 TGCCATAGCCTCTCTAGGCCTGG + Intronic
1119443130 14:74642285-74642307 AGCCCCAGCCTGGCCTGGCCCGG + Intergenic
1119479977 14:74953096-74953118 TGTCAGAGTATGGCCAGGCCCGG + Intronic
1119767225 14:77197941-77197963 AGCCATAGCCTGGCCAGGAGCGG + Intronic
1120610486 14:86635652-86635674 TTAAAGAGCCAGGCCAGGCCAGG + Intergenic
1121260048 14:92559381-92559403 GGCTTGAGCCTAGCCAGGCCTGG - Intronic
1121335702 14:93076414-93076436 TGTCGGAGTCTGCCCAGGCCAGG + Intronic
1121429413 14:93876470-93876492 TGCCAGGGCCTGGGCCTGCCTGG + Intergenic
1121571839 14:94952101-94952123 TGCCAGAGCTGAGCAAGGCCAGG + Intergenic
1121584566 14:95054491-95054513 GGCCAGGGCCTGGACAGGCGGGG + Intergenic
1122208612 14:100160604-100160626 GGCCAGAGCCTGGCCTCGGCTGG + Intergenic
1122350760 14:101088586-101088608 TGGCAGGGCCTGGCAGGGCCTGG + Intergenic
1122402240 14:101474362-101474384 TGGCAGCCCCAGGCCAGGCCCGG + Intergenic
1122417131 14:101555409-101555431 TGCCTGTGCATGGCCACGCCAGG - Intergenic
1122428000 14:101622861-101622883 TGCCAGAGCCGGGGCAGCCCAGG + Intergenic
1122913576 14:104845446-104845468 TACCAGGGGCTGGCCAGGCCTGG - Intergenic
1122918427 14:104869415-104869437 CGTCAGAGCCTGGCATGGCCCGG - Intronic
1122945552 14:105006994-105007016 TGGCAGGGCCGGGCCAGGCCAGG + Intronic
1123041566 14:105492359-105492381 GGCCAGAGCAAGGGCAGGCCTGG + Intronic
1202929981 14_KI270725v1_random:27706-27728 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1123422328 15:20143537-20143559 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
1123442673 15:20302805-20302827 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1123450886 15:20358248-20358270 AGCAAGAGCTTGGCCAGGGCAGG - Intergenic
1123531556 15:21150077-21150099 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
1123707393 15:22959983-22960005 TGCCAGACCCTGGCAGGGCCAGG - Intronic
1124025581 15:25962362-25962384 TACCTGAGACTGGCCAGGCACGG - Intergenic
1124209911 15:27754058-27754080 TGCCACAGCCTGTCCAGGGAAGG - Intergenic
1124335745 15:28855728-28855750 TGCCTCAGCCTCGCCATGCCTGG - Intergenic
1124512139 15:30336507-30336529 TCCCAGAGCCTGCTCAGGTCAGG + Intergenic
1124672860 15:31657257-31657279 AGACAGCCCCTGGCCAGGCCCGG - Intronic
1124730775 15:32194244-32194266 TCCCAGAGCCTGCTCAGGTCAGG - Intergenic
1125501950 15:40245434-40245456 GGCTAGAGCCTCTCCAGGCCAGG - Intronic
1126051801 15:44692966-44692988 TGCCAAAGCCTGGCTTGGTCAGG - Intronic
1126840779 15:52715492-52715514 TGCCAGAGGATGGCCAGGACAGG + Intergenic
1127293796 15:57592240-57592262 TGCCAGAGCCGGCACAGGACCGG - Intronic
1128127128 15:65201441-65201463 AGCCTGAGCTTGGCCAGGCACGG + Intronic
1128340579 15:66820003-66820025 TGTCACATCCTGGCCAGGCGCGG - Intergenic
1128378022 15:67091131-67091153 TGCCAGGGCATGGGCAGGGCAGG - Intronic
1128979528 15:72176175-72176197 TGCCAGGGCATGGCCCGCCCAGG - Intronic
1128980835 15:72184406-72184428 AGCCAGAGCTTGCGCAGGCCGGG + Intronic
1129117886 15:73375371-73375393 TGCCATAGCCTGGAGATGCCTGG - Intergenic
1129233585 15:74210014-74210036 TGCCAGAGCCAGGCCTGCCCAGG + Intronic
1130012115 15:80160082-80160104 TGCCCAAGCTAGGCCAGGCCAGG + Intronic
1130540314 15:84817264-84817286 TGCCCGGGTCGGGCCAGGCCAGG + Exonic
1130783119 15:87066083-87066105 TCCCCCAGCCTGGCCAGTCCAGG - Intergenic
1132301527 15:100779121-100779143 GGCGAGCACCTGGCCAGGCCCGG - Intergenic
1132450028 15:101961896-101961918 TGCTAGGGCCGGGCAAGGCCGGG - Intergenic
1132467328 16:83366-83388 TGCCACTTCCAGGCCAGGCCAGG + Intronic
1132515526 16:364153-364175 TTCCAGAGCCAGGCCGGGCTGGG - Intergenic
1132583574 16:696066-696088 GCCCAGGGCCTGGCCAGGGCAGG + Intronic
1132591601 16:728563-728585 TACCAGAGCCTGGCCGAGCTGGG + Exonic
1132599905 16:768773-768795 TGCCTGCTCCTGGCCAGGCGGGG - Exonic
1132625190 16:888217-888239 TGCCAGGGCCTGGGCGGGCAGGG - Intronic
1132745201 16:1433564-1433586 GGCCAGGGCATGGCCAGGTCTGG - Intergenic
1132770796 16:1561919-1561941 TGCAAGAGCCCAGCCAGGCAAGG + Intronic
1132775050 16:1588864-1588886 GGCCACAGCCCTGCCAGGCCAGG - Intronic
1132860092 16:2066308-2066330 TGCCACAGCCTGGACGGGCCTGG - Intronic
1132904671 16:2276426-2276448 TCCCAGAGCTGGGGCAGGCCGGG - Exonic
1132935234 16:2476649-2476671 CCCCACAGCCTGGCCAGGGCCGG + Intronic
1133021754 16:2969938-2969960 TGCCAGGGCCGGGGCAGCCCTGG - Intronic
1133336078 16:5007488-5007510 TGCCAGGGCCTGGCCGGGGAGGG + Intronic
1134186113 16:12086292-12086314 GGCAAGAGCGTGGCCAGGCGCGG - Intronic
1134882442 16:17757474-17757496 TCCCAAAGGCTGGCCAGGCGAGG - Intergenic
1135970093 16:27066204-27066226 TGGGAGAGCCAGACCAGGCCAGG + Intergenic
1135984597 16:27174770-27174792 TACCACAGCCTGGCCAGAGCAGG - Intergenic
1136192271 16:28623544-28623566 TGCTGGAGGCTGGCGAGGCCCGG - Exonic
1136455817 16:30379042-30379064 CTACAGAGCCTGGCCCGGCCTGG - Exonic
1136583934 16:31171425-31171447 ACCCAGAGCCTGTCCTGGCCAGG - Intergenic
1136773383 16:32859228-32859250 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1136897231 16:34002291-34002313 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
1137237044 16:46625099-46625121 TCCCAGGGCCAGGCCAGGCATGG - Intergenic
1137505652 16:49051799-49051821 TGGCAAGGCCAGGCCAGGCCAGG - Intergenic
1137578625 16:49620524-49620546 GGCCAGAGCCAGGCCTGTCCCGG - Intronic
1139512507 16:67435614-67435636 AGTCACAGCCTGGCCAGGCCAGG - Exonic
1139513253 16:67439209-67439231 TGGCAGAGCCTCCCCAGGCCAGG + Intronic
1139924617 16:70479302-70479324 GGCCAGAGCCTGGCTGGGGCAGG + Exonic
1140807532 16:78546834-78546856 TACCAGACCTGGGCCAGGCCCGG + Intronic
1140928060 16:79601240-79601262 TCCCTGAGCCTGGCCGTGCCCGG + Intergenic
1140956872 16:79874479-79874501 TGCAAGAGCCAGGCCAGGTCTGG - Intergenic
1141476515 16:84277434-84277456 AGCCAGAGCCTCGTCAGGCGCGG + Intergenic
1141925507 16:87166186-87166208 TGCCACAGCCTGACCAGCTCTGG + Intronic
1142119613 16:88379500-88379522 TGCCAGGGCCAGGCCAGGGGAGG + Intergenic
1142182757 16:88679213-88679235 TGCGGGAGGCTGGCCTGGCCAGG - Intronic
1142219915 16:88849016-88849038 TCCCAGAGCTGGGCCAGGTCTGG + Intronic
1142355574 16:89600052-89600074 AGCCCCTGCCTGGCCAGGCCTGG - Intergenic
1203075799 16_KI270728v1_random:1121338-1121360 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1203123918 16_KI270728v1_random:1559995-1560017 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1203141557 16_KI270728v1_random:1770630-1770652 TGCCAAACCCTGGCCAGGTGCGG - Intergenic
1142720319 17:1771565-1771587 CACCAGTGCCAGGCCAGGCCTGG - Intronic
1142794465 17:2296701-2296723 GGCTAGGGACTGGCCAGGCCCGG + Intronic
1142976099 17:3645435-3645457 TAGCAGAGCCTGGCCTGGCAGGG + Intronic
1143023780 17:3929566-3929588 TGCCAGGGCCTGTCCCGGGCTGG + Intronic
1143329661 17:6124021-6124043 TGCCAGAGCCTCTCCAGGGGTGG + Exonic
1143495763 17:7311872-7311894 GGCCAGAGCCAGGCCAGGCTCGG - Exonic
1143595971 17:7914252-7914274 TGCCAGAGTCTGGCCCGGCGCGG + Intergenic
1144445483 17:15323377-15323399 TCCCAGAGCCAGACCAGGGCAGG + Intronic
1144946119 17:18970368-18970390 GGCCAGGGCTTGGCCATGCCGGG + Exonic
1145031984 17:19511192-19511214 GGACACTGCCTGGCCAGGCCTGG + Intronic
1145210821 17:21011708-21011730 TCACAGAGCGTGCCCAGGCCAGG + Intronic
1145305540 17:21672613-21672635 AGCCAGAGCCTGGCCTCACCTGG + Intergenic
1145774494 17:27518583-27518605 TGCAAGAGCCTGGCAAGGTCAGG - Intronic
1146070142 17:29672995-29673017 TACCAGAGCTAGGCCAGGCACGG - Intronic
1146403603 17:32519263-32519285 TGCCAGGCACTGGGCAGGCCGGG + Intronic
1146456229 17:33011942-33011964 TGCCAGCTCCTGGCCATGCTTGG + Intergenic
1146722075 17:35130626-35130648 TGGCTGAGCCTGGCATGGCCTGG - Exonic
1146837686 17:36125491-36125513 TGCTGGAGCCAGGCCAGCCCTGG - Intergenic
1147140805 17:38459678-38459700 TTCCAGAACCTGCCCAGGGCTGG + Intronic
1147249279 17:39143584-39143606 GGCCTGGGCCTGGCCAAGCCTGG - Intronic
1147891465 17:43720552-43720574 GGCCACAGCCGGACCAGGCCAGG + Intergenic
1147918126 17:43900614-43900636 AGCCAAAGCCTGGCCGGGCTGGG + Intronic
1147964475 17:44186798-44186820 TCCCAGAGCGGGGCCACGCCTGG - Intergenic
1148082976 17:44977680-44977702 TCCCTGACCCTGGCCAGGGCGGG + Intergenic
1148104180 17:45110609-45110631 AGCCAGCCCCTGGCCAGACCTGG + Exonic
1148206766 17:45784355-45784377 AGCGAGAGCCGGGCCGGGCCGGG + Intronic
1148735602 17:49863008-49863030 TCCCAGGACGTGGCCAGGCCTGG + Intergenic
1148795347 17:50194306-50194328 GGTCAGGGCCTGGCCAAGCCAGG + Intronic
1148868985 17:50644419-50644441 TGCTAGAACTTGGCCAGGCATGG + Intronic
1149659316 17:58326124-58326146 GGGCAGAGGCTGGCCAGGCAAGG - Intronic
1150316885 17:64176237-64176259 AGCCAGAGCTTGACAAGGCCAGG + Intronic
1150692194 17:67376764-67376786 TTGCAGAGCCGGGCCAGGCGAGG + Intergenic
1150840455 17:68601293-68601315 TGCCGGCGCCAGGCCAGGCTCGG - Exonic
1151304702 17:73255846-73255868 TGCCACCTGCTGGCCAGGCCAGG - Intronic
1151582398 17:74987842-74987864 TGCCAGGGTCCGGCCCGGCCGGG - Exonic
1151600681 17:75104330-75104352 TTGCAGAGCCTGGACAGCCCGGG - Intronic
1151814928 17:76467100-76467122 TGCCAAGGCCTGGGCAGCCCTGG + Intronic
1151917445 17:77128742-77128764 TGCCCAAGCGTGGCCAGGCGCGG - Intronic
1151977083 17:77489152-77489174 TGCCAGAGCCTGGCCTGAGAAGG - Intronic
1152112677 17:78365893-78365915 TGCCAGAGGCCGGCTGGGCCTGG - Intergenic
1152178457 17:78802804-78802826 CGGCAGATCCTGGCCTGGCCCGG + Intronic
1152235780 17:79137626-79137648 TGCTGGCGCCTGGCCTGGCCCGG + Intronic
1152337557 17:79707097-79707119 GGCAAGAGCTTGGCCAGGGCAGG + Intergenic
1152377901 17:79928141-79928163 AGCCAGCCCCAGGCCAGGCCTGG - Intergenic
1152515007 17:80817904-80817926 TGCCAGAGTCTAGCAGGGCCGGG + Intronic
1152609967 17:81310558-81310580 TGGGAGGGCCCGGCCAGGCCCGG - Intergenic
1152621279 17:81366125-81366147 TGCCACAGCCAGGCCTGCCCTGG + Intergenic
1152927298 17:83093114-83093136 TTCCAGAGCCTGTCCCGTCCAGG + Intronic
1153174083 18:2351267-2351289 TCCGATTGCCTGGCCAGGCCGGG + Intergenic
1153459067 18:5313854-5313876 TGCATGAACCTGGCCAGGCGTGG + Intergenic
1153648172 18:7214059-7214081 TGCAAGAGCCTGGGGAAGCCTGG - Intergenic
1153868355 18:9293868-9293890 TGCAAAAACCTGGCCAGGCACGG - Intergenic
1154176445 18:12089166-12089188 TCCCAGACCCTGGCCCTGCCAGG + Intergenic
1154383252 18:13871172-13871194 TCCCAGAGCCAGGGCAGCCCCGG + Intergenic
1155517264 18:26636458-26636480 TGCCTGAGACTGGCCAGAGCTGG + Intronic
1155991736 18:32285377-32285399 TGCCAGGGCATGGACAGCCCTGG - Intronic
1157411825 18:47469495-47469517 GGCCTGGGCCAGGCCAGGCCAGG + Intergenic
1157606654 18:48930146-48930168 TACCAGGGCCTGGCCAGGCCAGG + Intronic
1157830191 18:50850519-50850541 AGCCAGAGCTTGGTCAGGCACGG + Intergenic
1160252413 18:77214469-77214491 TGCCAGAGGCTGGGCAAGGCAGG - Intergenic
1160328612 18:77972098-77972120 TGCCCTAGCCTGGCCTGGGCTGG - Intergenic
1160519690 18:79497579-79497601 AACAAGAGCCTGGCCAGACCAGG + Intronic
1160635226 19:70652-70674 TGCTAGGGCCGGGCAAGGCCGGG + Intergenic
1160708282 19:539944-539966 TGCCAGAGGCTGGGATGGCCAGG + Intronic
1160745904 19:710482-710504 AGCCACACCCTGCCCAGGCCTGG - Intronic
1160830764 19:1104099-1104121 TGGCCGCGCCTGGCCTGGCCGGG + Exonic
1160837343 19:1131161-1131183 TGCAGGAGCCTGGGCCGGCCTGG - Intronic
1160879328 19:1312449-1312471 GGCTGGAGCCGGGCCAGGCCAGG - Intergenic
1160906507 19:1453937-1453959 TGCCAGGGCTCAGCCAGGCCTGG + Intronic
1161051732 19:2167506-2167528 AGCCAGGGCCTGGCCAGGGAGGG - Intronic
1161112721 19:2479063-2479085 TCCCGGCGCCTGGCCAGGGCGGG - Intergenic
1161190748 19:2953912-2953934 TGCAAAAGCCTGGCCAGGCGCGG + Intergenic
1161346805 19:3772244-3772266 TGCCGGAGCCGAGCCAGGTCGGG + Intergenic
1161357567 19:3827441-3827463 TGGCAGAGCCTGGGCCGGGCGGG + Intronic
1161422192 19:4182146-4182168 TTCCAGAGCCGGGCCAGGACGGG - Intronic
1161582833 19:5090257-5090279 AGCCTCAGCCTGGCGAGGCCAGG - Intronic
1161660695 19:5544163-5544185 TGGCAGGGGCGGGCCAGGCCGGG - Intergenic
1161808712 19:6459504-6459526 CGCCAGGGGCTGGCCAGGCTGGG - Exonic
1162328115 19:10010536-10010558 CTCCAGCGCCTGGCCAGGCGGGG + Intergenic
1162368116 19:10261784-10261806 TGACAGTGCCTGGCCCAGCCTGG + Intergenic
1162572032 19:11479672-11479694 TGCCCGGGCGTGGCCAGGCAGGG + Intronic
1162907744 19:13833624-13833646 TGCCAGAGCCGGGGCAGGAGAGG + Intergenic
1163427440 19:17246917-17246939 AGCCAGAGGCTCGCCAGCCCGGG - Intronic
1163444554 19:17338940-17338962 GGCCAGAGCCTGGCGGGGCAGGG - Exonic
1163683850 19:18699709-18699731 CCCCAGAGCCAGGCGAGGCCAGG - Intronic
1163798282 19:19349577-19349599 TCCCACAGCCTGGGCAGGCAGGG + Intronic
1164203451 19:23038465-23038487 AGCCAGAGCTGAGCCAGGCCTGG + Intergenic
1164226994 19:23254515-23254537 TGCCAGAGCTGAGCCAGGTCTGG - Intergenic
1164620720 19:29694698-29694720 TGTCTGGGCCTGGCCTGGCCTGG + Intergenic
1165172002 19:33899906-33899928 TATCAGAGACTGGCCAGGCATGG - Intergenic
1165263068 19:34637194-34637216 TGCCAGGGCGAGGCCAAGCCTGG + Intronic
1165308048 19:35014087-35014109 TTCCAGAGCCTGTGCAGACCCGG - Intronic
1165329883 19:35135466-35135488 TGGCAGAGAGTGGCCAGGACGGG - Intronic
1165654353 19:37520338-37520360 TGTGAGTGCCTGGGCAGGCCAGG + Intronic
1165741128 19:38205964-38205986 CACTAGAGCCAGGCCAGGCCGGG - Intronic
1165828605 19:38719530-38719552 AGGAAGGGCCTGGCCAGGCCGGG + Intronic
1165856457 19:38881431-38881453 TGTCAGAGCCTGGTGAAGCCTGG - Exonic
1166046667 19:40234253-40234275 TGCGAGAGGCAGGCCAGGACAGG - Intronic
1166140054 19:40800649-40800671 AGCCTGAGCCTGGCCGGGCCAGG + Exonic
1166258369 19:41621222-41621244 TGGCAAAGCCTGGACAGGCTGGG - Intronic
1166364111 19:42269893-42269915 AGCCAGGGCCTGGGCTGGCCTGG + Intronic
1166364297 19:42270665-42270687 TGCCAGAGCCAGCCCAGCCAGGG + Intronic
1166693062 19:44835727-44835749 TGCCAGGGGCTGGCCAGGCATGG - Intergenic
1166751369 19:45165331-45165353 TGGCACAGCCCGGCCAGGGCAGG + Intronic
1167095615 19:47373551-47373573 TGTCAGGGCCTGGCCAGTGCGGG - Intronic
1167216820 19:48170648-48170670 AGCAAGGGCCGGGCCAGGCCTGG + Intergenic
1167261746 19:48462720-48462742 GCCCAGAGCCTTGACAGGCCAGG - Intronic
1167608934 19:50496862-50496884 TGGCACCGCCTGGCCTGGCCTGG + Intergenic
1168145837 19:54419818-54419840 TGCCAGATACTGACCAAGCCAGG + Intronic
1168267228 19:55229617-55229639 AGCCAGTGCCTGGCCCAGCCTGG + Intergenic
1168307247 19:55442375-55442397 GGCCAGGGCCCGGCCAGGCCGGG - Exonic
1168316642 19:55487457-55487479 TCCCAGAGAGGGGCCAGGCCTGG - Exonic
1168535450 19:57165513-57165535 AGCCAGACCCTGGCCGGGCACGG + Intronic
1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
1202692145 1_KI270712v1_random:100288-100310 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
925134524 2:1516826-1516848 TTCCAGGGCCTGGGCAAGCCAGG - Intronic
925844162 2:8020568-8020590 TGTCAGAGCCGGGCCTGGGCTGG - Intergenic
925846572 2:8039915-8039937 TGCTGGAGCATGGCCAGGTCTGG - Intergenic
926059569 2:9796643-9796665 CACCAGAGCAAGGCCAGGCCCGG + Intergenic
926121369 2:10242968-10242990 TCCCGGAGCCGGGCCAGCCCTGG - Intergenic
926685023 2:15691591-15691613 AGCCAGAGCCAGGGCAGGCTGGG - Intronic
927152597 2:20204386-20204408 AGCCTGAGCTTGGCCAGCCCAGG - Intronic
927192550 2:20526767-20526789 AGCCACCACCTGGCCAGGCCTGG - Intergenic
927513672 2:23659783-23659805 CCACAGAGGCTGGCCAGGCCTGG - Intronic
927698445 2:25252525-25252547 TCCCAGGGCCCGCCCAGGCCGGG + Intronic
927910974 2:26899549-26899571 TCCCAGAGCCTGGACTGACCTGG + Intronic
928170073 2:28997970-28997992 CACCAGAGCCTGGCAGGGCCAGG - Intronic
928435288 2:31250998-31251020 TGCAAGAGCATGGCCTGCCCAGG + Intronic
928787493 2:34906976-34906998 TTCAAGAGTCTGGGCAGGCCAGG + Intergenic
928987033 2:37191806-37191828 TGACAGGGCCAGGCCAGCCCAGG + Intronic
929194191 2:39168443-39168465 TGACTGAGCCAGGCCAGGCGCGG + Intergenic
929589493 2:43135802-43135824 GGCAGGAGCCTGGCCAGGACTGG + Intergenic
929777754 2:44939214-44939236 TGCCACTGCCCGGCCAGCCCCGG - Intergenic
930022076 2:47007663-47007685 TGCCAGGGCCTGGCCTGCCTCGG - Intronic
930029345 2:47048891-47048913 AGCCAGAGACAGGCCAGGCATGG - Intronic
931160463 2:59684548-59684570 GGCCAAAGACTGGCCAGGTCAGG + Intergenic
931515361 2:63047976-63047998 CTCCAGAGCCTGGCCGGGCCTGG + Intergenic
932306579 2:70707908-70707930 TGCCTGTGGCTGGCCAGTCCTGG + Intronic
932414161 2:71563877-71563899 AGCCAGACACTGGCCAGCCCTGG + Intronic
932636827 2:73396937-73396959 TACCAGAGCCTAACCAGGCTGGG - Intronic
933954254 2:87353684-87353706 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
933974680 2:87498894-87498916 AGCCACAGCCTGGCCACACCGGG - Intergenic
934238449 2:90249904-90249926 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
934274742 2:91566806-91566828 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
934322981 2:91983915-91983937 TGCCAGCGCCGGTCCAGGGCAGG - Intergenic
934460872 2:94213246-94213268 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
934736342 2:96691665-96691687 AGCCAGGGCCTGGCCTGGCTGGG + Intergenic
935208969 2:100922287-100922309 CTCCAAAGCCTGGCCAGGCATGG + Intronic
935309763 2:101772007-101772029 TCCCTCAGCCTGGCAAGGCCAGG + Intronic
935653950 2:105405755-105405777 TCCTAGAGCCTGGCCAGTCCAGG - Intronic
936319144 2:111451920-111451942 AGCCACAGCCTGGCCACACCGGG + Intergenic
936507697 2:113120905-113120927 CTCCAGATCCTGGCCAGGCCAGG - Intronic
936566254 2:113584391-113584413 TGCTAGGGCCGGGCAAGGCCGGG - Intergenic
936600407 2:113889919-113889941 GGCCTGGGCCTGGCCTGGCCGGG + Intergenic
937297515 2:120818489-120818511 TGCCAGTGCCTGGCCCAGCTCGG - Intronic
938872587 2:135496090-135496112 TTCCACAGACTGGCCAGGCGTGG + Intronic
939084852 2:137707441-137707463 TGGCAGGGCTTGGCCAGCCCAGG - Intergenic
940737803 2:157472906-157472928 TGCCATAGCCTGTCCAAGCTTGG + Intronic
941176155 2:162199613-162199635 TGCCAGGGTCTGGACAGGTCAGG + Intronic
941580953 2:167294218-167294240 TGCCAGAGGCGCACCAGGCCGGG - Intergenic
942448336 2:176092866-176092888 GGCCGGGGCCGGGCCAGGCCGGG + Intergenic
944842196 2:203635133-203635155 TGCCTGAGCCTGTCCAGCACTGG + Intergenic
944843528 2:203646309-203646331 TGCCTGGGCCTTGCTAGGCCTGG + Intergenic
945253062 2:207780530-207780552 TGCAAGAGGCAGGCCAGGCATGG + Intergenic
945434914 2:209808567-209808589 TGCGCGAGCCCAGCCAGGCCCGG + Intronic
945724665 2:213461964-213461986 TGACAATGCCTGGACAGGCCAGG + Intronic
946114801 2:217451892-217451914 TGCCAGAGACTGGACAGCTCAGG + Intronic
946399728 2:219461951-219461973 TCCCAGAGCCTGGGGAGACCTGG + Exonic
947740339 2:232481930-232481952 TGCCACCTCCTGGCCCGGCCAGG - Intronic
948050370 2:234975325-234975347 TGCCTGCACCTCGCCAGGCCTGG - Intronic
948159379 2:235811733-235811755 GGCCAGAGCTGGGCCGGGCCGGG - Intronic
948462964 2:238139083-238139105 CCCCAGTGCCTGCCCAGGCCCGG - Intronic
948492476 2:238322008-238322030 TCCCAGGGCCTCGCCAGCCCTGG + Intronic
948797530 2:240412499-240412521 AGGCAGGGCCAGGCCAGGCCCGG + Intergenic
948801692 2:240436111-240436133 GCCCAAAGCCCGGCCAGGCCCGG - Intronic
948903557 2:240967607-240967629 TGACCCAGCCTCGCCAGGCCTGG - Intronic
948939869 2:241190355-241190377 CTCCACAGCCAGGCCAGGCCAGG - Intronic
948989025 2:241542361-241542383 TCCCATAGTCTGGCGAGGCCGGG - Intergenic
1168876872 20:1177891-1177913 GGCCAGAGGCTGGTCAGGTCAGG - Intronic
1168893507 20:1308885-1308907 TGCCTGAGCCTGGACTGGCCGGG - Exonic
1169489112 20:6056324-6056346 GGCAAGGGCCTGGCCTGGCCAGG + Intergenic
1169830312 20:9817879-9817901 TGCCAGAGATTGGCCATGCCTGG - Intronic
1170569088 20:17622793-17622815 TGCCACCACCTGGACAGGCCTGG + Intronic
1170609143 20:17897653-17897675 TACCAGAGCCTGGGAAGGGCAGG + Intergenic
1170656214 20:18289321-18289343 TCCCAAAGCCTGGCCACACCAGG - Intronic
1170737922 20:19027008-19027030 TGCCAGGGCCTGGGCAGCCCAGG - Intergenic
1171019366 20:21571530-21571552 CCCCAGAGCCAGGCCAAGCCTGG + Intergenic
1171260111 20:23724560-23724582 TACTAGTACCTGGCCAGGCCTGG + Intergenic
1171523055 20:25790102-25790124 AGCCAGAGCCTGGCCTCACCTGG + Intronic
1171530793 20:25852079-25852101 AGCCAGAGCCTGGCCTTACCTGG + Intronic
1171553772 20:26065781-26065803 AGCCAGAGCCTGGCCTCACCTGG - Intergenic
1172113262 20:32559863-32559885 CGGCAGGGCCTGGGCAGGCCTGG - Intronic
1172868809 20:38121679-38121701 TGCCAGACTCTTGCCAGGCGCGG - Intronic
1172993836 20:39055419-39055441 TCCCAGCGACTGGCCAGGCACGG + Intergenic
1173020051 20:39259590-39259612 AGCCAGGGCCTGGCCAGGCTTGG - Intergenic
1173145291 20:40519576-40519598 GGCCAGAGCGTGGCCAGGCTAGG - Intergenic
1173518073 20:43679115-43679137 GGTAAGAGCCTGGCCAGGGCAGG + Intronic
1173545272 20:43892993-43893015 GCCCAGAACCTGGCCAGTCCAGG + Intergenic
1173760192 20:45553130-45553152 TGCCAGGGCCTGGACAGGTAAGG - Exonic
1174051596 20:47771072-47771094 TCACAGAGGCTGGCCAGGCCTGG + Intronic
1174615517 20:51832507-51832529 TGCCAGACCATGGCCAGCCAGGG - Intergenic
1175210951 20:57354363-57354385 TCCCAGGGCCTGGCCCAGCCAGG + Intronic
1175240723 20:57546296-57546318 TGACAGTGCCTTGCCAGCCCTGG + Intergenic
1175545209 20:59773495-59773517 AGCCTGAGGCTGGCCAGGCAGGG - Intronic
1175662813 20:60831440-60831462 AGCCTGAGCATGGCCAGGGCAGG - Intergenic
1175734573 20:61376397-61376419 AGCCAGGCTCTGGCCAGGCCTGG + Intronic
1175878037 20:62239523-62239545 TGCCGGAGCCAGGCTAGGCCAGG - Intronic
1175904003 20:62370999-62371021 TTCCAGACCCTGCCTAGGCCAGG - Intergenic
1175939647 20:62532137-62532159 TGACGGAGGCTGGCCAGGCATGG - Intergenic
1176034501 20:63029595-63029617 TGGCAGCGCCAGGTCAGGCCTGG - Intergenic
1176104299 20:63378565-63378587 TAATAGAGGCTGGCCAGGCCCGG - Intergenic
1176146088 20:63566168-63566190 TGCCAGAGCCTGCTCAGCCCTGG - Exonic
1176150888 20:63590187-63590209 TGCTGGAGCCAGGCGAGGCCTGG + Exonic
1176207233 20:63895535-63895557 TGCGGGAGCCGGGCCGGGCCGGG + Intronic
1176592978 21:8660164-8660186 GGCCAGTGTATGGCCAGGCCAGG - Intergenic
1176604775 21:8820004-8820026 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1176858125 21:13986881-13986903 TCCCAGACCCTGGCCCTGCCAGG + Intergenic
1176866450 21:14057270-14057292 TCCCAGACCCTGGCCCTGCCAGG - Intergenic
1177366913 21:20151455-20151477 AGCCAGAGCCGGGGCAGGCAGGG + Intergenic
1178974113 21:37207489-37207511 TGCCACCGCCTGGCCTTGCCTGG + Intergenic
1179552158 21:42150424-42150446 TCCCAGAGCCAGGGCAGGCATGG - Intergenic
1179718628 21:43302941-43302963 AGGCAGAGCCCGGCCCGGCCTGG + Intergenic
1179792723 21:43764734-43764756 TACCGGATGCTGGCCAGGCCCGG - Intergenic
1179827298 21:43973363-43973385 TGCCAGATCCTGGCCACAGCTGG + Intronic
1179887959 21:44322459-44322481 TGTCCCTGCCTGGCCAGGCCAGG + Intronic
1179937351 21:44613898-44613920 TTGAAGAACCTGGCCAGGCCTGG - Intronic
1180275830 22:10637307-10637329 GGCCAGTGTATGGCCAGGCCAGG - Intergenic
1180333322 22:11552619-11552641 TACCAGAGGCTGGCAAGGGCAGG + Intergenic
1180347065 22:11711609-11711631 TGCCAGACCCTGCCCTGGCCCGG - Intergenic
1180354813 22:11829699-11829721 TGCCAGACCCTGTCCCGGCCCGG - Intergenic
1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG + Intergenic
1180549313 22:16528333-16528355 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1180877119 22:19179703-19179725 TCCCAGAGCCTGGGGAGGCCAGG - Exonic
1181167393 22:20991093-20991115 TGGCATAGCCCTGCCAGGCCAGG + Intronic
1181355379 22:22293503-22293525 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
1181486832 22:23236892-23236914 TGCCAGAGCCAGCACAGGGCTGG - Intronic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1181632644 22:24159329-24159351 AGGCAGTGCCTGACCAGGCCGGG + Intronic
1181639916 22:24190947-24190969 TGCCAGGGGCAGGCCAGGCTGGG + Intergenic
1181884404 22:26008747-26008769 TGCCAGACCCTGGACAGCCCAGG - Intronic
1182420981 22:30248464-30248486 TACCTGAGCCAGGCCAGGGCAGG - Intergenic
1182485101 22:30634814-30634836 GGCCAGGGCCTGGCCTAGCCTGG + Intergenic
1182504257 22:30770804-30770826 GGCAAGAGCCAGGGCAGGCCAGG - Intronic
1183180730 22:36258049-36258071 TGGCAGGCACTGGCCAGGCCAGG - Intronic
1183261918 22:36800658-36800680 AGCCAATGCCTGACCAGGCCTGG + Intergenic
1183305302 22:37079929-37079951 CCCCATAGCCAGGCCAGGCCGGG + Intronic
1183362633 22:37390610-37390632 TGCAAAGGCCTGGGCAGGCCTGG + Intronic
1183367076 22:37412571-37412593 TGCCTGGTACTGGCCAGGCCTGG - Intronic
1184067982 22:42130974-42130996 TGGCAGAGTCAGGCCAGGGCGGG + Intergenic
1184070719 22:42144647-42144669 TGGCAGAGTCAGGCCAGGGCAGG + Intergenic
1184621756 22:45684400-45684422 TGCCAGACCATGGCCAGATCTGG + Intronic
1184651079 22:45919751-45919773 CCCCAGAGCCTGGCCATGGCAGG - Intergenic
1184853522 22:47134454-47134476 CGCCAGCTCCTGGCCAGGACAGG + Intronic
1185089034 22:48755665-48755687 TGTGGGAGCGTGGCCAGGCCTGG + Intronic
1185157318 22:49201839-49201861 TGCCCCAGCCAGTCCAGGCCTGG + Intergenic
1185235816 22:49712331-49712353 CCCCAGAGCCGGGCCAGGCTGGG + Intergenic
950206975 3:11088388-11088410 TCCCAGATCCTGGGCAAGCCGGG - Intergenic
950422920 3:12909222-12909244 TGCCAGAGTCTGGCAAGTCTCGG + Intronic
950645999 3:14377104-14377126 TCACAGAGCCAGGCCAAGCCAGG - Intergenic
950669108 3:14514532-14514554 TGCCAGGGCCTGCCCATCCCGGG + Intronic
952419361 3:33117627-33117649 GGCCACAGCCAGGCAAGGCCTGG - Intronic
952451843 3:33440292-33440314 CGCTAGAGCCTGGGCGGGCCGGG - Exonic
954127036 3:48537413-48537435 TTCTAGAGCCAGCCCAGGCCGGG - Intronic
954129045 3:48550432-48550454 TGCCAGAGCCCAGGCGGGCCTGG - Intronic
954320615 3:49829929-49829951 TGCCAGAGCCTTGTCACTCCTGG - Intronic
954391273 3:50269271-50269293 GCCCAGAGCAGGGCCAGGCCCGG - Exonic
954620972 3:51995377-51995399 TCCCAGACCCTGGCAAGGACTGG - Intronic
954993501 3:54861215-54861237 TGACCTAGCCTGGCCAGGTCAGG + Intronic
956051980 3:65257811-65257833 TACCTGAGACTGGCCAGGCATGG - Intergenic
956392533 3:68788873-68788895 TCCCAGAGCCTTGGAAGGCCAGG - Intronic
956452757 3:69390600-69390622 TGCTACACCCTGGCCAGGCACGG + Intronic
958732285 3:97972334-97972356 TCCCAGCGCCGGGGCAGGCCGGG - Exonic
959492529 3:107007700-107007722 TGCCTAAGTCTGGCCAGGCATGG + Intergenic
959632133 3:108518626-108518648 TGCCCCAGCCAGGTCAGGCCTGG - Intronic
961175419 3:124831242-124831264 TCCCAGAGGCAGGCCAGGCATGG + Intronic
961321749 3:126081999-126082021 TGCCAGAGGAAGGCCTGGCCAGG + Intronic
961327055 3:126115042-126115064 AGCATGAGCCTGGCCAGGGCAGG + Intronic
961328948 3:126127721-126127743 TGCCAGAGGAGGGCCTGGCCAGG - Intronic
961453875 3:127014915-127014937 TGGCAGAGCATGGCCAGACAAGG - Intronic
961536777 3:127575541-127575563 AGGCAGAGCCTGGCCTGTCCAGG - Intronic
961594774 3:128007282-128007304 AGCCAGAGGCTGGGCAGGTCTGG - Intergenic
961734628 3:128993756-128993778 TGCAGGAGCCTGGCGAGGTCGGG + Intronic
961775589 3:129282165-129282187 TGTATGAGCCTGGCCAGGCCTGG + Intronic
961954539 3:130787969-130787991 TTTCATAGCCTGGCCTGGCCTGG - Intergenic
962396117 3:135016659-135016681 AGCCAGACCCTGGCCAGGGTGGG - Intronic
962745561 3:138395325-138395347 TGGCATAGTCTGGCCAGGCGCGG - Intronic
962756517 3:138469190-138469212 AGCCAGAGCTGGGCCTGGCCAGG - Intronic
963102470 3:141620462-141620484 TTACAGAGCCTGGGAAGGCCCGG + Intergenic
963773818 3:149418512-149418534 AGCCAGACCCAGGCCAGGCGTGG + Intergenic
964014762 3:151931093-151931115 TGCCAGTGCCAGACCAGGCATGG - Intergenic
964729853 3:159853174-159853196 TGCCAGAGCAAGGAAAGGCCAGG + Intronic
967198015 3:187046146-187046168 TACCACAGCCTGGGCAGGCCTGG - Intronic
968463023 4:735213-735235 AGGCACAGCCTGGGCAGGCCTGG - Intronic
968551060 4:1223556-1223578 TGCAAGGGCCTTGCCATGCCAGG - Intronic
968628791 4:1639593-1639615 GGGCAGAGCCTGGCCAGGAAGGG + Intronic
968889765 4:3362218-3362240 TTCCAGACCCTGCCCAAGCCAGG + Intronic
968962518 4:3752772-3752794 TGCCTGAGCCTGGCCTGGCAGGG + Intergenic
969428148 4:7137903-7137925 TGGGCGACCCTGGCCAGGCCTGG + Intergenic
969647080 4:8437482-8437504 TGCCACTGCCTGGCCCCGCCAGG + Intronic
969695922 4:8734828-8734850 AGCCCTGGCCTGGCCAGGCCAGG - Intergenic
970449836 4:16155944-16155966 AGACAGAGCCAGGCCAGGCTGGG + Intergenic
970781420 4:19742253-19742275 AGCCAAAGACTGGTCAGGCCTGG + Intergenic
972354651 4:38269096-38269118 TGCCAAGCCCTGGACAGGCCAGG - Intergenic
972588372 4:40460044-40460066 TGCCAGCTCCTGGCCAGGCGTGG - Intronic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
973373347 4:49270933-49270955 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
973387661 4:49524275-49524297 TGCCAGACCCTGCCCCGGCCTGG - Intergenic
975612219 4:76214009-76214031 CGCCTGAGCCAGGCCCGGCCTGG + Intergenic
975661872 4:76696579-76696601 TGTCATAGGCTGGCCTGGCCTGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
979376933 4:119957289-119957311 GGCCAGTCCCTGGCCAGGCATGG - Intergenic
983267482 4:165522688-165522710 TACCTGAGACTGGCCAGGCATGG - Intergenic
983969591 4:173855622-173855644 TGGCAGAGCCTGTCCAAGCTGGG - Intergenic
984799336 4:183699082-183699104 AGCCAGAGCCTGACCAGGTGAGG - Intronic
985870051 5:2547235-2547257 TTCCAGAGCCCCGGCAGGCCAGG + Intergenic
986025121 5:3843359-3843381 TGCCAGGGACAGGCCAGACCAGG - Intergenic
986646625 5:9922576-9922598 TGCCTCAGGCTGGCCAGGGCTGG - Intergenic
988277947 5:29107114-29107136 TGCCTGAGCCTGCCCAGGATAGG + Intergenic
989108612 5:37886376-37886398 TCCCACAGCCTGGCCAGACTAGG - Intergenic
989282862 5:39665271-39665293 TGGCAGGGCCAGGCCAGTCCAGG + Intergenic
991447345 5:66714474-66714496 TGCCACTGTCTGGACAGGCCTGG + Intronic
994143981 5:96372370-96372392 TGCCAGACCTTGGCCAGGGGTGG + Intergenic
994748006 5:103702710-103702732 AGCCACAGGCTGGCCAGGCGCGG - Intergenic
995140358 5:108728369-108728391 GCCCAGACTCTGGCCAGGCCCGG - Intergenic
997310962 5:132882169-132882191 TGCCACAGCCTGGGCAGCCTGGG + Intronic
997697147 5:135870609-135870631 GGGCACAGCCTGGCCAGGGCTGG + Intronic
998156129 5:139788199-139788221 TGGGGGAGCCGGGCCAGGCCTGG - Intergenic
998208355 5:140175395-140175417 TGCCTGAGCCAGGCCAGCCCGGG - Intronic
999262206 5:150245121-150245143 TGCCAGAGCCAAGCCCTGCCAGG + Intronic
999331110 5:150673968-150673990 CGCCAGAGCCTAGCTAGGCCTGG + Intronic
1000657621 5:163900420-163900442 TTGCAGAGCCTGGCCGGGCATGG + Intergenic
1001163149 5:169339202-169339224 TGGCAGAGCTTGGCCAAGACTGG + Intergenic
1001583493 5:172816763-172816785 AGGCAGAGCCTGGCCAGGGGAGG + Intergenic
1001605742 5:172958758-172958780 TGCCCGTGCCTGGCCCCGCCGGG - Intronic
1001820249 5:174704658-174704680 TGCCATCAGCTGGCCAGGCCAGG - Intergenic
1002176767 5:177405053-177405075 TGCCAGCGGCTGGCCAGCCAGGG - Exonic
1002313347 5:178328021-178328043 TTCCAGGCTCTGGCCAGGCCTGG + Intronic
1004043966 6:12009201-12009223 TGCCTGAGCCGGGCCCGGCCGGG + Intronic
1004193946 6:13487582-13487604 TCCCAGAGCCTGAGCCGGCCTGG - Intronic
1006113610 6:31763473-31763495 TGCTACAGCATGGCCAGGCCTGG + Exonic
1006389588 6:33750724-33750746 AGCCAGAGCATGGCGAGCCCAGG - Intergenic
1006416755 6:33908929-33908951 ATCCAGAGCCTGGCCACCCCGGG - Intergenic
1006716647 6:36124631-36124653 TTCCAGAGGCTGGCTAGGCTCGG + Intergenic
1007071265 6:39040061-39040083 TGCCAGAGCCTCCCCATTCCAGG + Intergenic
1007174688 6:39887796-39887818 TGCCAGACGCTGACCAGGCTGGG - Intronic
1007419801 6:41712699-41712721 TGCCAGGCCCTGGGCAGGCACGG + Intronic
1007492540 6:42234629-42234651 AACCAGAGCTTGGCCAGGCGCGG - Intronic
1007494793 6:42252381-42252403 TGCCTGAGCCTGTCCATGTCAGG - Intronic
1007607210 6:43125578-43125600 TCCCAGACCCTGGCCAGGGAAGG - Intronic
1007647711 6:43395769-43395791 TCCCAGAGCCAGGCTGGGCCAGG + Intergenic
1007693579 6:43718044-43718066 TGCTACGGCCAGGCCAGGCCAGG - Intergenic
1007746151 6:44044041-44044063 TCCCAGACCCAGGCCTGGCCTGG - Intergenic
1007951747 6:45878701-45878723 TGCCAAAGAGTGCCCAGGCCTGG + Intergenic
1009306915 6:62102625-62102647 TGTCAGGGCCAGGCCAGCCCAGG - Intronic
1012862087 6:104572118-104572140 AGCCTGGGCCTGGCCAGGTCTGG - Intergenic
1013623613 6:111915700-111915722 TGCTAGACCCTGGACATGCCTGG - Intergenic
1014508622 6:122292191-122292213 AGCTATAGCCTGGCCTGGCCAGG + Intergenic
1017715780 6:157212072-157212094 GGCGGGAGCCTGGGCAGGCCAGG - Intergenic
1017770039 6:157638052-157638074 TGCCAGAGTGTGGCCAGCCCAGG + Intronic
1017909074 6:158777397-158777419 AGCCAGAGTCTGGCCAGTCATGG - Intronic
1018393026 6:163355155-163355177 TGCCAGGGGCCGGCCAGGCTGGG - Intergenic
1018873353 6:167799576-167799598 AGCCAGAGTCCGGCCACGCCAGG - Intergenic
1018903592 6:168063184-168063206 TAAGAGAGCCTGGCCATGCCGGG + Intronic
1019423590 7:962983-963005 AGCCAGAGCCTGGGCGGGGCAGG - Intronic
1019475056 7:1240441-1240463 TCCTAGACCCTGGCCAGCCCAGG - Intergenic
1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG + Intronic
1019522450 7:1466986-1467008 TGTCTGAGCCAGGCCAGGCAGGG - Intergenic
1019816623 7:3205794-3205816 TGCCAGCCCCAGGCCAGGCCAGG + Intergenic
1020660346 7:10974116-10974138 GGCCAGGGCCAGGCGAGGCCGGG + Exonic
1020806633 7:12797891-12797913 TACAACAGCCTGGCCAGGCGCGG - Intergenic
1021608309 7:22431839-22431861 TACCAGAGCCTGGCAAGAGCTGG - Intronic
1021920069 7:25475947-25475969 TACAAGAGCCTGCCCAGGCCAGG - Intergenic
1022111929 7:27237192-27237214 CCCAAGAGTCTGGCCAGGCCTGG - Intergenic
1022997121 7:35768546-35768568 TGCCAGGGCCTTGGCAGGCAGGG + Intergenic
1023262111 7:38368511-38368533 TGCCAGAACCTGGTCCTGCCAGG + Intergenic
1023883402 7:44334502-44334524 CCCCAGGTCCTGGCCAGGCCTGG + Intronic
1023995896 7:45158647-45158669 TGACTGAGCCTGGCCAGTTCTGG + Intronic
1024281883 7:47725245-47725267 GGCCAGGAGCTGGCCAGGCCAGG + Intronic
1024780118 7:52837854-52837876 TGCCAGAGGCTGGGAGGGCCTGG - Intergenic
1025283490 7:57645022-57645044 AGCCAGAGCCTGGCCTCACCTGG + Intergenic
1027218412 7:76198876-76198898 TGCAAAAGCCTGGTCAGGCGCGG - Intergenic
1028289717 7:89049719-89049741 TCCCACAGTCTGGCCAGGCATGG + Intronic
1029111732 7:98216194-98216216 GGCGAGAGGCTGGCCCGGCCCGG - Exonic
1029210996 7:98908266-98908288 TGCCAGATCCTGGGCCTGCCAGG - Intronic
1029250820 7:99234887-99234909 TACCAGTGCCTGGCCGGGCGCGG - Intergenic
1029416270 7:100445059-100445081 TCCTGGAGCCTGGCCTGGCCTGG - Intergenic
1029548010 7:101221511-101221533 AGCCAGCGCCTGGTGAGGCCGGG - Intronic
1032078095 7:128845645-128845667 GGCCAGACCCTGGCTAGGCATGG + Intronic
1032780896 7:135164676-135164698 GGCCTGGGCCTGGCCAGGCTTGG + Exonic
1033448425 7:141441588-141441610 TGCCTGGAGCTGGCCAGGCCTGG + Intronic
1033578647 7:142711466-142711488 TCCCAGAGCCTGGACACACCAGG - Intergenic
1033683912 7:143621721-143621743 TGCCAGACCCTGGAGAAGCCAGG + Intronic
1033687088 7:143700910-143700932 TGCCAGACCCTGGAGAAGCCAGG + Intronic
1033700700 7:143835917-143835939 TGCCAGACCCTGGAGAAGCCAGG - Intergenic
1034415378 7:150961841-150961863 TGGCAGATGCTGGCCAGGCTCGG + Intronic
1034446424 7:151116272-151116294 TGGCAGAACAGGGCCAGGCCAGG + Intronic
1034977633 7:155457667-155457689 GGCCAGGGCCCGGCCGGGCCGGG - Intergenic
1035045288 7:155961750-155961772 GGCCAGAGCCAGCCCAGGGCTGG + Intergenic
1035361915 7:158318784-158318806 TGGCAGAGCCTGGCTGGTCCGGG + Intronic
1035577810 8:719151-719173 TCCCTGAGCCTCGCCAGGCCTGG - Intronic
1036283728 8:7424389-7424411 GTCCAGAGCCTGGGCTGGCCTGG + Intergenic
1036337743 8:7887140-7887162 GTCCAGAGCCTGGGCTGGCCTGG - Intergenic
1036544794 8:9757263-9757285 TACCAGAGGCTGGCCAGGTGTGG - Intronic
1037588897 8:20296515-20296537 TGCCACAGATTGGCCAGCCCAGG + Intronic
1037805864 8:22057616-22057638 AGCCAGTGGCTGGCCAGGCTGGG + Intronic
1039110663 8:34037923-34037945 TGCCAAAAGCTGGCCAGGCATGG - Intergenic
1039379387 8:37070731-37070753 TGCTGGATCCTGGACAGGCCAGG + Intergenic
1041673763 8:60517422-60517444 GGCCGCGGCCTGGCCAGGCCCGG + Intronic
1042310928 8:67378943-67378965 TCCCACAGCCAGGCCATGCCTGG + Intergenic
1044745349 8:95365545-95365567 GGCAAGTGCCTGGCCAGGCGCGG + Intergenic
1044754557 8:95447678-95447700 TGCAAGAACCTGGCCGGGCACGG - Intergenic
1045754562 8:105527564-105527586 TGCCAGCGCCTGGCCAAGGCTGG - Intronic
1046239309 8:111470634-111470656 TGCCCGAGCCGGAACAGGCCAGG - Intergenic
1047188902 8:122660367-122660389 TGCCACAGCCGGGGAAGGCCAGG - Intergenic
1048321537 8:133404132-133404154 TCCCAGAGTCTGGCCTGGCCTGG - Intergenic
1048573399 8:135672779-135672801 TGCCATGCCCTGGCCAGCCCTGG + Intergenic
1048687438 8:136919687-136919709 TGGCAGGGCCAGGCCAGCCCAGG - Intergenic
1048872638 8:138812073-138812095 TGGCTGAGCCTGGGCCGGCCAGG - Intronic
1048872990 8:138814107-138814129 TGCCAGGGCCTGGCCCTGCCTGG + Intronic
1049159582 8:141088851-141088873 CCCCAGGGCCTGGCCTGGCCCGG - Intergenic
1049610592 8:143553102-143553124 TGCCAGACACTGTCCTGGCCTGG - Intergenic
1049748940 8:144274531-144274553 TTCAGGAGCCAGGCCAGGCCCGG - Intronic
1049886279 9:29158-29180 TGCTAGGGCCGGGCAAGGCCGGG + Intergenic
1051022056 9:12556517-12556539 TGCCAGACCCTTGCCTGGCATGG + Intergenic
1051216281 9:14801286-14801308 TTCCACAGCGTGGCCGGGCCTGG - Intronic
1051375783 9:16400958-16400980 GGTCAGAGCCTGACCAGGCATGG - Intergenic
1052891983 9:33709943-33709965 TCCCAGAGCCTGGACACACCAGG - Intergenic
1053016997 9:34667562-34667584 TGCCAGAGACAGCCCTGGCCTGG - Intergenic
1053431192 9:38042828-38042850 GCCCAGAGCCTGGCCTGGCCTGG - Intronic
1053691368 9:40588944-40588966 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1053691466 9:40589322-40589344 GGCCAGAGCAGGGCAAGGCCAGG - Intergenic
1054273337 9:63048163-63048185 GGCCAGAGCAGGGCAAGGCCAGG + Intergenic
1054273434 9:63048541-63048563 TGTCAGAGCATGTCCAGGGCAGG + Intergenic
1054302628 9:63389915-63389937 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1054302724 9:63390288-63390310 GGCCAGAGCAGGGCAAGGCCAGG - Intergenic
1054401400 9:64716415-64716437 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1054401498 9:64716793-64716815 GGCCAGAGCAGGGCAAGGCCAGG - Intergenic
1054435008 9:65200735-65200757 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1054435106 9:65201113-65201135 GGCCAGAGCAGGGCAAGGCCAGG - Intergenic
1054495284 9:65820568-65820590 GGCCAGAGCAGGGCAAGGCCAGG + Intergenic
1056135895 9:83629170-83629192 TGGCAGAGCCTGTTCAGGCTGGG - Intronic
1056590865 9:87964576-87964598 GGGAAGAGCCTGGCCAGGCAAGG + Intergenic
1057192275 9:93094793-93094815 TGCCAGAGCCTGACCCGGAATGG - Intergenic
1057194975 9:93111754-93111776 TGCCACAGCCTGGTTCGGCCTGG + Intronic
1057438013 9:95059905-95059927 TGCAACAGCAGGGCCAGGCCTGG - Intronic
1057646037 9:96876037-96876059 TGGCAGAACCTGGCCAGGCGAGG - Intergenic
1059484596 9:114617065-114617087 GGCCTGAGCCTGGGCAAGCCGGG - Intronic
1060182932 9:121546276-121546298 GGCCGGGGCCTGGCGAGGCCTGG - Intergenic
1060419514 9:123457759-123457781 AGCCAGACCCAGGCCAGACCAGG + Intronic
1060996689 9:127878055-127878077 TGCCAGAGAGAGGCCAGACCAGG + Intergenic
1061036169 9:128115498-128115520 TGCCCGCTCCTGGCCAGCCCAGG - Intergenic
1061177815 9:129008206-129008228 GGGGAGAGCCTGGCCAGGGCTGG - Exonic
1061227870 9:129291205-129291227 GGCCAGAGCCTGGCTAGGGGTGG - Intergenic
1061289468 9:129642369-129642391 TGCCAGGGCCCGGCCCGGCTCGG + Intergenic
1061651865 9:132057057-132057079 TGCCAGGCCCTTGCAAGGCCTGG + Intronic
1061745109 9:132733858-132733880 TGCCCGCCCCTGGCCAGTCCAGG - Intronic
1062029379 9:134355297-134355319 TAACAGTGCCTGGCCTGGCCGGG - Intronic
1062038849 9:134395069-134395091 GGACAGAGCCCAGCCAGGCCAGG - Intronic
1062352680 9:136146967-136146989 TCCCAGAGCCTGGCCAGGGCGGG + Intergenic
1062354081 9:136153648-136153670 TGGCAGAGCCTGCCCCGCCCTGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
1203492311 Un_GL000224v1:118880-118902 TGCCAGAGACTGGGCAGGTGCGG + Intergenic
1203504934 Un_KI270741v1:60752-60774 TGCCAGAGACTGGGCAGGTGCGG + Intergenic
1203552153 Un_KI270743v1:172093-172115 TGCCAGACCCTGCCCCGGCCCGG - Intergenic
1203622047 Un_KI270749v1:135135-135157 TGTCAGAGCATGTCCAGGGCAGG - Intergenic
1185608888 X:1382505-1382527 TGCAGGCGCCTGGCCCGGCCAGG - Exonic
1185718784 X:2365428-2365450 GGCCAAAACCTGGCCAGGCACGG - Intronic
1187960737 X:24564210-24564232 TGATGGAGCCTGGCCCGGCCCGG + Intronic
1189147642 X:38671789-38671811 TACCAGAGCTTTGCAAGGCCTGG + Intronic
1190717391 X:53115433-53115455 TTCCAGGGCCAGGCCAGCCCAGG - Intergenic
1191112842 X:56821215-56821237 TGGGAGAGGCTGGCCAGGCATGG - Intergenic
1192314148 X:70038997-70039019 TTCAGGAGCCTGGCCAGGCAGGG + Exonic
1193049059 X:77082190-77082212 TCCCAGAGCCTGGCTGGGCTGGG + Intergenic
1195716959 X:107826724-107826746 TGCCCGCGCCGGGCCCGGCCAGG - Intronic
1197770976 X:130089107-130089129 TACCAGGGCCTGGCCAGACAGGG + Intronic
1198534668 X:137574424-137574446 TGTGAGAGCCGGGCCAGGGCCGG + Intronic
1200988582 Y:9327717-9327739 TGCCAGAACCTGGGCAGTCATGG - Intergenic
1201060261 Y:10038175-10038197 TGCCAGAACCTGGGCAGTCATGG - Intergenic
1202119408 Y:21508475-21508497 TGCCAGAACCTGGGCAGTCATGG + Intergenic
1202121860 Y:21532015-21532037 TGCCAGAACCTGGGCAGTCATGG + Intronic
1202157146 Y:21897367-21897389 TGCCAGAACCTGGGCAGTCATGG - Intronic
1202159592 Y:21920908-21920930 TGCCAGAACCTGGGCAGTCATGG - Intergenic
1202186037 Y:22185823-22185845 TGCCAGAACCTGGGCAGTCATGG - Intergenic
1202205322 Y:22400573-22400595 TGCCAGAACCTGGGCAGTCATGG + Intronic