ID: 973339276

View in Genome Browser
Species Human (GRCh38)
Location 4:48986926-48986948
Sequence TGGGCTGGGCCCAGGACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 433}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973339266_973339276 17 Left 973339266 4:48986886-48986908 CCAGGAGCTGTAGGTGGACACTG 0: 1
1: 0
2: 3
3: 13
4: 230
Right 973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG 0: 1
1: 0
2: 6
3: 62
4: 433
973339264_973339276 19 Left 973339264 4:48986884-48986906 CCCCAGGAGCTGTAGGTGGACAC 0: 1
1: 0
2: 0
3: 11
4: 161
Right 973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG 0: 1
1: 0
2: 6
3: 62
4: 433
973339260_973339276 27 Left 973339260 4:48986876-48986898 CCCGTTTTCCCCAGGAGCTGTAG 0: 1
1: 0
2: 0
3: 21
4: 200
Right 973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG 0: 1
1: 0
2: 6
3: 62
4: 433
973339261_973339276 26 Left 973339261 4:48986877-48986899 CCGTTTTCCCCAGGAGCTGTAGG 0: 1
1: 0
2: 4
3: 23
4: 323
Right 973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG 0: 1
1: 0
2: 6
3: 62
4: 433
973339265_973339276 18 Left 973339265 4:48986885-48986907 CCCAGGAGCTGTAGGTGGACACT 0: 1
1: 0
2: 2
3: 10
4: 164
Right 973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG 0: 1
1: 0
2: 6
3: 62
4: 433

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973339276 Original CRISPR TGGGCTGGGCCCAGGACAAG TGG Intronic
900118159 1:1037332-1037354 TGGGCTGTGGCCAGGTGAAGGGG - Intronic
900208317 1:1440950-1440972 GGAGCTGGGCCCAGGGCAGGTGG + Exonic
900234893 1:1583731-1583753 TCGGCTGGGCCCAGCACAGATGG + Intergenic
900403483 1:2482486-2482508 TGTGCTGGGCCCAGTGCATGTGG + Intronic
900431304 1:2604354-2604376 TGGGGTGGGCGTAGGACATGGGG + Intronic
901021599 1:6258815-6258837 TGGGCGGGGCCAAGGTCACGGGG - Intronic
901209988 1:7519274-7519296 TGGGCAGGGGCCAGGAGAGGTGG + Intronic
901648400 1:10728866-10728888 TGGGCCGGGCCCAGCACACGGGG + Intronic
902746225 1:18476377-18476399 GGGGCTGGGTGCAGGGCAAGGGG - Intergenic
903063160 1:20684237-20684259 AGTGCTGGGCCCAGGACACAAGG - Intronic
904599397 1:31665388-31665410 TGGGCTGGGGCCCACACAAGAGG + Intronic
904833397 1:33320030-33320052 TGAGCTAGGCCCAGGTCAAATGG - Intronic
905224374 1:36469609-36469631 TGGGCAGGGCCAGGGACAAAGGG - Intronic
905823081 1:41009211-41009233 TGGGCGGGACCCTGGACAGGAGG + Intronic
906047487 1:42843182-42843204 AGGGCTGGGCCAAGGTCAGGGGG - Exonic
906510466 1:46407851-46407873 TTGGCTGGGGCGAGGGCAAGAGG - Intronic
906676709 1:47698428-47698450 TGGGCTGGGGCCAGGAGACCGGG + Intergenic
906682355 1:47737453-47737475 TTGGCTGAGCCCAGGGCAATGGG + Intergenic
908241353 1:62191746-62191768 TGGGCTGGGCAAAGCACATGAGG - Intergenic
909781832 1:79558076-79558098 TGAACTGGGCCCAGAACCAGAGG + Intergenic
909873849 1:80778905-80778927 TGCTGGGGGCCCAGGACAAGAGG - Intergenic
912701721 1:111882836-111882858 TGGGCTGGGCCGAGGTCCTGGGG - Intronic
913335802 1:117708263-117708285 TGGGCTGGGGCCAGGACACCCGG + Intergenic
914970308 1:152303688-152303710 CGGGCTGGGCCCAGTACTGGAGG - Exonic
914970624 1:152305632-152305654 TGGACGGGGCCCAGCACTAGAGG - Exonic
914970779 1:152306604-152306626 TGGACGGGGCCCAGCACTAGAGG - Exonic
915525916 1:156476139-156476161 TGGACTAGGCCCTGGACTAGGGG - Intronic
916073614 1:161187060-161187082 TGGGCTGGGCCCTGGAGAACAGG - Exonic
916121086 1:161528722-161528744 TGGGCCAGGGCCAGGAAAAGAGG - Intergenic
916572359 1:166038865-166038887 AGGGCCGGGCCCAGGAGCAGGGG - Intergenic
918484712 1:185016942-185016964 TGGGCTCCTCCCATGACAAGTGG + Intergenic
919905605 1:202076235-202076257 TGGGCTGGGCTGAAGATAAGAGG + Intergenic
920339742 1:205268324-205268346 TGGGCTGGGGCCAGGCGTAGTGG + Intronic
920945285 1:210523166-210523188 TGTGGTGGGCCCAGGACACGGGG - Intronic
922800941 1:228364501-228364523 AGGGCCTGGCCCAGGAGAAGGGG + Intronic
922831593 1:228557181-228557203 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922832070 1:228609163-228609185 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922832631 1:228611404-228611426 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922833191 1:228613645-228613667 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922833752 1:228615886-228615908 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922834309 1:228618127-228618149 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922834871 1:228620358-228620380 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922835420 1:228622561-228622583 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922835979 1:228624803-228624825 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922836536 1:228627043-228627065 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922837096 1:228629284-228629306 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922837655 1:228631526-228631548 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922839331 1:228638232-228638254 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922839892 1:228640463-228640485 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922840453 1:228642704-228642726 TGGGCTGCGCCCAGAACACGGGG + Intergenic
922841015 1:228644935-228644957 TGGGCTGCGCCCAGAACACGGGG + Intergenic
923085966 1:230703845-230703867 GGGGCTGGGCCCAGGGCACCAGG + Intronic
923703157 1:236319016-236319038 TGGGCTGAGGCAAGGACATGTGG + Intergenic
924006227 1:239614635-239614657 TATGCTGGGCCCAGGAAAAATGG + Intronic
924941265 1:248813672-248813694 TGGGCACCGTCCAGGACAAGTGG + Intronic
1063088356 10:2839563-2839585 AGGGCTGGGATCAGGACAACAGG + Intergenic
1063351806 10:5363409-5363431 TGGGCTGAGCTGATGACAAGGGG - Intergenic
1064245468 10:13664414-13664436 TGGTCTTGGCCAAGGACAACAGG + Intronic
1066654541 10:37686064-37686086 AGGGCTGGGCCCAGGGGCAGTGG + Intergenic
1067039502 10:42941523-42941545 AGGGCTGGGCCCAGGGGCAGTGG + Intergenic
1067058990 10:43068167-43068189 TGGGCAGGGCCCAGGACGGATGG + Intergenic
1067343730 10:45423427-45423449 TGGGATGGGTCCAGGAAAGGTGG - Intronic
1067700017 10:48564655-48564677 TGGCCTGGCCCCAGCACATGAGG - Intronic
1068582399 10:58756535-58756557 TAGGGTGGGACCAGGACAAGAGG - Intronic
1069774269 10:70917738-70917760 TGGGGTGGGCCCCGGACTGGTGG - Intergenic
1069785200 10:70983424-70983446 TGTGCTGGGCCAATGACATGTGG + Intergenic
1069869019 10:71521855-71521877 AAGGCTGGGCCAAGGTCAAGAGG - Intronic
1071947114 10:90657918-90657940 TGAGTGGGGCCCAGAACAAGGGG - Intergenic
1072520982 10:96229904-96229926 AGGGCTGGGCACAGGACTGGAGG + Intronic
1075725040 10:124606717-124606739 TGGGCTGGGCCTGGGGCAGGGGG + Intronic
1076055429 10:127368481-127368503 TGGGGTGGGCACAGGGCGAGGGG - Intronic
1076628865 10:131840672-131840694 GGGGCTGTGCCCAGGACACCAGG + Intergenic
1076719274 10:132386171-132386193 TGGGCTGTGCCCAGGGCCTGAGG - Intergenic
1076911764 10:133394022-133394044 TGGGCGGGGCCCGGGCCCAGAGG - Intronic
1077324757 11:1958896-1958918 TGGCCTGGGCCCAGTCCCAGGGG + Intronic
1077864964 11:6214636-6214658 TGGGCTGGGAACAGGCCCAGTGG - Intronic
1078317502 11:10305355-10305377 CGAGCTGGGCCCAGGATATGGGG - Exonic
1078343351 11:10518990-10519012 TGGGCTGGGCCAAGGTCAGTGGG - Intronic
1078986676 11:16605113-16605135 CGGGCTCGGCCCAGGGCAGGGGG - Intronic
1079330608 11:19529732-19529754 TGTGAGGGGCTCAGGACAAGGGG - Intronic
1080858400 11:36131853-36131875 TGGGCTGGGCAAAGGACCAGAGG + Intronic
1080896173 11:36450303-36450325 GGGGCTGTGCCCAGCCCAAGGGG - Intronic
1082855118 11:57799093-57799115 AGGGCTGGGCCCAGGGGTAGAGG + Intronic
1083685712 11:64373664-64373686 AGGAAGGGGCCCAGGACAAGGGG + Intergenic
1083779148 11:64909234-64909256 TGGACTGGGCCCAGGAGAGGAGG - Intronic
1084269117 11:68019734-68019756 TGGGCGGGCCCCAGGAGACGGGG + Exonic
1084446927 11:69209205-69209227 GGGCCTGGGCCCAGGTCAGGGGG - Intergenic
1084476313 11:69391593-69391615 TGGGCAGTGCCCAGCACAAGGGG - Intergenic
1084873848 11:72116291-72116313 AGGGCTGGGCTAAGGATAAGTGG - Intronic
1084954089 11:72682257-72682279 TGGTCTGAGCACAAGACAAGGGG - Intergenic
1085311423 11:75519171-75519193 TGGGCAGACCCCAGGACCAGTGG - Intronic
1085518367 11:77124241-77124263 TGGGTTGGGCCTAGGACACGAGG - Exonic
1086184694 11:83999223-83999245 TGGGCTGGGCCCTGGCCCAGAGG - Intronic
1087628686 11:100624967-100624989 TTTGCAGGGCCCAGGTCAAGAGG - Intergenic
1088712818 11:112523846-112523868 TGGGAGGGGCCCAGGACAATGGG + Intergenic
1089163613 11:116458149-116458171 TGGGCTGGGGAAGGGACAAGTGG + Intergenic
1089673349 11:120072466-120072488 TGGCCTGGGCTCAGAAGAAGAGG + Intergenic
1089704976 11:120271506-120271528 GGGGCTGGGGCCAGGAGAGGTGG - Intronic
1090260477 11:125315396-125315418 TGGGCTGGGCCTCGGGCAGGAGG - Intronic
1202807737 11_KI270721v1_random:14073-14095 TGGCCTGGGCCCAGTCCCAGGGG + Intergenic
1092060630 12:5547635-5547657 TGGGCAGGGCAGAGGGCAAGTGG + Intronic
1093714039 12:22361205-22361227 TGGACTGGGCACTGGAGAAGGGG - Intronic
1096869574 12:54584884-54584906 AGAGCTGGGGCCAGGACCAGGGG - Intronic
1097276458 12:57816818-57816840 AGGGCTGGGCCTGGGACAAAGGG + Intronic
1097508550 12:60507182-60507204 TGGGCTGGGCTCAGAACCAGTGG + Intergenic
1099119142 12:78665738-78665760 TGAGCTGGGTACAGGACCAGTGG - Intergenic
1100269913 12:93014783-93014805 TGAGATGATCCCAGGACAAGAGG + Intergenic
1100709549 12:97240917-97240939 TAGGTTGGGGCCAGGATAAGAGG - Intergenic
1101492897 12:105226261-105226283 TTGGCTGGGCCAAGGACACTTGG - Intronic
1101599570 12:106197458-106197480 TCCTCTGGGCCCAGGGCAAGAGG + Intergenic
1102243688 12:111341761-111341783 TAGGCTGGGGCCAGGAAGAGAGG - Exonic
1102959686 12:117084660-117084682 TGGGAGGGGCCCAGGAGCAGAGG + Intronic
1104103232 12:125634958-125634980 TGAACTGGGCCCAGGGCCAGTGG - Intronic
1104103553 12:125637838-125637860 TTGCCTGGGGCCAGGAGAAGAGG + Intronic
1104804414 12:131575900-131575922 TGCGCTGAGCCCAGGGCAGGTGG - Intergenic
1104822220 12:131683756-131683778 TGAGCTGGGCCCAGGCCTGGGGG + Intergenic
1104896909 12:132169111-132169133 TGGGGTGGGGCCAGGACCAGGGG - Intergenic
1106756157 13:32824919-32824941 TGAGCTGGGCCCTGAAGAAGAGG - Intergenic
1106804935 13:33296565-33296587 GGGGCTGGGCCCAGGGATAGGGG - Intronic
1108972968 13:56400885-56400907 TGTGCTGGGCTCAGGGCCAGTGG + Intergenic
1112563461 13:100533256-100533278 TGTGCTGGGCTCAGGAGCAGGGG - Intronic
1116079332 14:40153879-40153901 TGAGCTGGGCCCAGAGCCAGTGG + Intergenic
1116541842 14:46109586-46109608 TGTGCTGGGCTGAGGGCAAGTGG + Intergenic
1116903220 14:50381126-50381148 TGAGTAGGACCCAGGACAAGAGG + Intronic
1117447513 14:55818848-55818870 TGGGCTGGGCAAAGCACATGAGG + Intergenic
1118034252 14:61849356-61849378 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
1119444534 14:74652416-74652438 TGGGCTGTGCCCATGGAAAGTGG + Intergenic
1119480344 14:74954670-74954692 TGGGCTGGGGACGAGACAAGGGG - Intronic
1121556136 14:94839205-94839227 TGGCCTGGGGCCAGGGGAAGAGG + Intergenic
1121619653 14:95337317-95337339 GAGGCTGGGCCGTGGACAAGGGG + Intergenic
1121864504 14:97350098-97350120 TGGGCTGGGCCCAGAGGATGTGG + Intergenic
1122403090 14:101479017-101479039 TGGCCTGTGGCCAGGACAGGAGG - Intergenic
1122408494 14:101514147-101514169 GGGGCTGGTCCTAGGACAGGAGG - Intergenic
1122505275 14:102227831-102227853 GGGGCTGGGGCCAGGACCACTGG + Intronic
1122663830 14:103315615-103315637 AGTGCTGGGCCAAGGACGAGGGG - Intergenic
1122789907 14:104179789-104179811 GAGGCTGGGCGCCGGACAAGAGG + Exonic
1122862271 14:104587963-104587985 CTGGCAGGGCCCAGGACATGGGG + Intronic
1123019986 14:105393155-105393177 GGGGCTGGGGCCAGGGCCAGGGG - Intronic
1123114840 14:105890019-105890041 TGGGCTGTGCCCTGGACCTGTGG + Intergenic
1123121799 14:105920195-105920217 TGAGCTGGGCCCTGCAGAAGGGG + Intronic
1123404496 15:20011846-20011868 TGAGCTGGGCCCTGCAGAAGGGG + Intergenic
1123513829 15:21018493-21018515 TGAGCTGGGCCCTGCAGAAGGGG + Intergenic
1124415504 15:29470319-29470341 TTGGCAGGGCCCAGGACCTGTGG - Intronic
1124600311 15:31128285-31128307 TGGGCACAGCCCAGGACAGGGGG - Intronic
1125747303 15:42005609-42005631 TGGGATGGCCCCAGGAACAGAGG - Intronic
1126514673 15:49521294-49521316 TGGGCTGCCCCAAGGAAAAGGGG + Intronic
1126660783 15:51031204-51031226 TGTTCTGGGCTCAGAACAAGTGG - Intergenic
1127730915 15:61801176-61801198 TGAGCTGGGACCAGACCAAGGGG - Intergenic
1127877399 15:63122509-63122531 TGGGCGGGGCCCAGGTGGAGGGG + Intronic
1128334881 15:66779428-66779450 AGTGCCAGGCCCAGGACAAGGGG + Intronic
1128758538 15:70199147-70199169 TGGTCTGGGCCATGGAGAAGGGG - Intergenic
1128800526 15:70494053-70494075 TGGCCTGCGCTCAGGACAGGTGG + Intergenic
1129206013 15:74037369-74037391 AGGGCTGGGGCCAGGACACAGGG - Intronic
1129207905 15:74048169-74048191 TGGACATGGGCCAGGACAAGGGG - Intergenic
1129330068 15:74822605-74822627 TGTCCTGGGCCCTAGACAAGAGG + Intronic
1131944836 15:97608662-97608684 TGTGCTGGGCTCAGGGCCAGTGG + Intergenic
1132640896 16:977796-977818 TGTGTTGGGCCCAGGGCACGAGG - Intronic
1133317163 16:4892031-4892053 TGGACTTGGCCCAGGAGAAGTGG - Exonic
1133337667 16:5016517-5016539 TGGGCTGGGCGCAAGTCAATGGG - Exonic
1134490345 16:14691461-14691483 ATGGCTGGGCTCAGGCCAAGGGG - Intronic
1134495726 16:14730578-14730600 ATGGCTGGGCTCAGGCCAAGGGG - Intronic
1134501272 16:14770889-14770911 ATGGCTGGGCTCAGGCCAAGGGG - Intronic
1136239859 16:28937207-28937229 TGGACTGGGCCCTGGAGGAGAGG + Intronic
1136351766 16:29714102-29714124 TGGTCTGGTCCCCAGACAAGAGG + Intergenic
1136746498 16:32596191-32596213 TGGCCTGGGGCCAGGGCAAATGG - Intergenic
1137475832 16:48809870-48809892 TGGTCAGGGCTCAGGAAAAGAGG - Intergenic
1137580613 16:49631520-49631542 TGGGCTGGGCCCCAGGGAAGGGG - Intronic
1137772044 16:51024266-51024288 TGGGCTGGCACAAAGACAAGGGG + Intergenic
1138349708 16:56339959-56339981 TGGGATGAGCCCAGGCCAAGTGG - Intronic
1138845017 16:60554713-60554735 TGGGCTGGGCTCAGAGCCAGAGG - Intergenic
1139286449 16:65819135-65819157 TGAGCTGGGACCAGGTCATGGGG - Intergenic
1140192324 16:72828633-72828655 TGGGCAGGGCCCTGCACAGGTGG - Intronic
1141833281 16:86521716-86521738 TGGGCTGGCCGCAGGTCACGGGG + Intergenic
1142109316 16:88322814-88322836 TGGACTTGGCCCAGGACTTGGGG + Intergenic
1142195576 16:88737886-88737908 TGGGCTGAGGCCAGGCCATGGGG - Intronic
1142256972 16:89018753-89018775 TGGGCTGGGCTCAGGAGGATGGG - Intergenic
1203048627 16_KI270728v1_random:855395-855417 TGGCCTGGGGCCAGGGCAAATGG - Intergenic
1142959742 17:3545122-3545144 AGGGCTGGGCCCAGGGCAAGGGG + Intronic
1144677814 17:17173066-17173088 TGGGATCAGCCCTGGACAAGAGG - Intronic
1144727774 17:17510519-17510541 GGGGCAGGGCCCAGGACCACTGG + Intronic
1146186419 17:30727369-30727391 TGGCCAGGGCCCAGGACTAGAGG + Intergenic
1146628628 17:34454266-34454288 TGTGCTGAGCCCAGGAAATGTGG + Intergenic
1146669174 17:34725012-34725034 TGAGCTGGGCACATGAAAAGTGG + Intergenic
1146691344 17:34878213-34878235 TGGGCTGGGCACAGAACCATTGG + Intergenic
1147019708 17:37521500-37521522 GGGGCAGGGCCCAGGGAAAGAGG + Intronic
1147419648 17:40316111-40316133 AGGGCTGGGCCTTGGACAGGTGG + Intronic
1147446297 17:40477223-40477245 TGGGCAGGGCCCAGGTCGATGGG + Exonic
1147931963 17:43987372-43987394 TGGGCTGGGCCCAGAGGAATAGG - Intronic
1148104532 17:45112344-45112366 AGGGGTGGGCTGAGGACAAGAGG + Exonic
1148439982 17:47707004-47707026 AGGTCTTGTCCCAGGACAAGGGG - Intronic
1148504826 17:48119123-48119145 GTGGCTGGGCCCAGGAAGAGAGG + Exonic
1148858259 17:50590893-50590915 TGGGTGGGGTCAAGGACAAGAGG - Intronic
1149686841 17:58540617-58540639 TGGGGTGGGCCCAGGAAGACTGG + Intronic
1149754319 17:59174892-59174914 TGGGCTGGAGGCTGGACAAGGGG - Intronic
1150218801 17:63484482-63484504 TGGGCTGGCCCGAGTACCAGTGG + Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1151466624 17:74289775-74289797 AGGGCTGGGACCAGCACAAGTGG + Intronic
1151576074 17:74953216-74953238 TGGGCTGGGCCTAGGGCCTGGGG - Intronic
1151686400 17:75649500-75649522 TGGGGTGGGCTCAGCAGAAGTGG - Intronic
1152424466 17:80211408-80211430 TGGGGTGGGCCCGGGACAGCAGG - Intronic
1152529256 17:80907456-80907478 AGGGCTGGGCCGAGGACCAGAGG - Intronic
1152612649 17:81323217-81323239 TGAGCTGGGCCCAGAACACCTGG + Intronic
1152927631 17:83094674-83094696 AGGCCTGGGCCCAGGGCATGCGG - Exonic
1152941599 17:83175639-83175661 TGGGGTGGGGGCAGGACCAGCGG - Intergenic
1153724512 18:7941298-7941320 TGTGCTGGGACAGGGACAAGAGG + Intronic
1154402758 18:14057243-14057265 TGGGCAGAGCCCATCACAAGGGG + Intergenic
1155191777 18:23437018-23437040 TGGGCTGGCCCCAGCCAAAGTGG - Intronic
1155226671 18:23735225-23735247 TGGCCTGGAACCAGGACAAGGGG + Intronic
1156503904 18:37577140-37577162 TGGCCTGGGGCCCAGACAAGAGG - Intergenic
1157584111 18:48790496-48790518 TGAGCTGGGCCCAGGCCAAAGGG - Intronic
1158016430 18:52789876-52789898 TGGTCTGGTCCCCAGACAAGAGG - Intronic
1158323845 18:56293282-56293304 ATGGCGGGGCCCATGACAAGTGG + Intergenic
1158398989 18:57104062-57104084 GGGGCTGTGCCTAGGGCAAGGGG - Intergenic
1158649561 18:59273471-59273493 GGGGCTGGGTCCAGGGCGAGAGG - Intronic
1159092108 18:63861038-63861060 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
1160419720 18:78735671-78735693 TGGGCTGGCACCAGCACACGTGG + Intergenic
1160659920 19:293125-293147 TGGGATGGGGCCAAGCCAAGAGG + Intergenic
1160923857 19:1533700-1533722 TTGGCTGGGGCCAGGACACAGGG - Intronic
1161197336 19:2994105-2994127 TGGGCTGGGGGCAGGACCCGGGG + Intronic
1161381480 19:3967465-3967487 TGGGCTGGGGCCAGGCACAGTGG + Intronic
1161507672 19:4652626-4652648 TGGGCGGGGGCCAGGAGGAGAGG - Exonic
1161608448 19:5227974-5227996 TGGGGTAGACCCAGGCCAAGGGG + Intronic
1161704458 19:5812619-5812641 TGGGGTGGGCCCAGGCCCTGGGG + Intergenic
1162178833 19:8852383-8852405 TGGGCTGGGCCCAAGGGCAGTGG + Intronic
1162661031 19:12169156-12169178 TGGGGTGGGCCCTGGACTTGTGG + Intronic
1162930378 19:13954440-13954462 GAGGCTGGGCCCAGGCAAAGGGG + Intronic
1162972427 19:14188682-14188704 TGGCCAGGGCCCAGGACTAGAGG - Intronic
1163313370 19:16527135-16527157 AGGGTTGGGCTCAGGACAATGGG - Intronic
1163703916 19:18801311-18801333 TGGGGGGGTCCCAGGACAAGGGG - Intergenic
1164750219 19:30648218-30648240 GGGGCTGGGCCCACAAGAAGCGG + Intronic
1165782795 19:38443655-38443677 TGGGCAGGGGCCAGGGCATGTGG + Intronic
1166437888 19:42785165-42785187 TGGGCTGGGGCCAGGGCATGTGG - Intronic
1166456836 19:42948957-42948979 CGGGCTGGGGCCAGGGCATGTGG - Intronic
1166486589 19:43219455-43219477 CGGGCTGGGGCCAGGGCATGTGG - Intronic
1166763481 19:45238818-45238840 TGGGCTGGGCCCCGGGCCGGCGG - Intronic
1166853389 19:45770864-45770886 GGGGCTGGGCCCACGGCAGGAGG - Intronic
1167592782 19:50413546-50413568 TGAGATGGGCCCAGGGCAGGTGG + Intronic
1167668516 19:50836654-50836676 TGAGCTGGAGCCAGGCCAAGGGG - Intronic
1167674672 19:50876970-50876992 TGTGCTGGGCTCTGGACAGGTGG + Exonic
1167686111 19:50957871-50957893 GGGGCTGGGCCCAGGAGGGGTGG - Intergenic
1167829649 19:52008832-52008854 AGGGCTGGACTCAGGAGAAGTGG + Intergenic
1168267087 19:55229018-55229040 TTGTTGGGGCCCAGGACAAGGGG - Exonic
1168391157 19:56009049-56009071 TGGCCTGGGGCCAGGTCTAGTGG + Intronic
926637517 2:15198568-15198590 TGTGCTGGGGCCAGAACATGAGG + Intronic
927154269 2:20212706-20212728 TGGGCCCGGCCCAGGGCAGGAGG + Intronic
927563371 2:24089654-24089676 TAGGCTGGTCCCAAGACAATAGG - Intronic
927690306 2:25203477-25203499 TGAACTGGGGCCAGGACTAGGGG - Intergenic
928381571 2:30822751-30822773 TGGGCAGGGCCCAGCCCAGGAGG - Intergenic
928662820 2:33520753-33520775 TGGGATGGACTCAGAACAAGTGG - Intronic
929099914 2:38301790-38301812 TGGGCTGGGCTCAGAGCCAGTGG + Intronic
930873075 2:56186081-56186103 TGTGCTGGGCCCAGTTCAGGTGG + Intronic
931464798 2:62476715-62476737 TGGTTTGGGGCCTGGACAAGGGG + Intergenic
932321754 2:70827518-70827540 GGGGCTGGGCCCTGGGCATGGGG - Intergenic
932416258 2:71575408-71575430 TGCCCTGGGGCCAGGTCAAGGGG + Intronic
932430850 2:71672811-71672833 AGGGCTGGGGCCCGGAAAAGGGG + Intronic
932517488 2:72368006-72368028 TGGGCTGGGCTCAGAGCCAGAGG + Intronic
932889411 2:75579247-75579269 TGTGCTGGGCCCAGAGCCAGTGG + Intergenic
933446553 2:82387286-82387308 TGGGCTGGGCTCAGAGCCAGAGG + Intergenic
933633274 2:84680536-84680558 AGGGCTGGGCACAGGAAGAGGGG + Intronic
934475142 2:94588579-94588601 TGGGCTGGGTGGAGGACAGGGGG - Intronic
934527840 2:95062612-95062634 CGGGCTGGGCAGGGGACAAGAGG - Intergenic
935877226 2:107523123-107523145 TAGGCTTTGCCCAGGAAAAGAGG - Intergenic
936865354 2:117071618-117071640 GGGACTGGCCCCTGGACAAGGGG + Intergenic
937338590 2:121076809-121076831 TCGGCTGTGCCCAGGACAGATGG - Intergenic
937985796 2:127637567-127637589 TGGGCAGCGCCCAGGACAGAGGG - Exonic
938116114 2:128603892-128603914 TGGGCTGGGCGGTGGACAAGCGG - Intergenic
938244490 2:129766237-129766259 AGGGCTGGGCCCAGGACCCAGGG - Intergenic
940006863 2:149016313-149016335 TGGGCTGGACCCTGAAGAAGGGG + Intronic
940093992 2:149952857-149952879 TGGTCAGGGCTCAGGAGAAGGGG - Intergenic
941832852 2:169980967-169980989 TGGGCTGGGGCTATGTCAAGGGG + Intronic
942452371 2:176116335-176116357 AGGGCCGGGTCCAGGACAAGCGG - Intronic
942618801 2:177825257-177825279 TGAGCTGAGCACAGGAGAAGAGG + Intronic
943763227 2:191632172-191632194 AGAACTGGGCCCAGGAAAAGAGG + Intergenic
943984921 2:194606231-194606253 TGGTCTGGTCCCTGGGCAAGAGG + Intergenic
945937661 2:215919435-215919457 TGTGCAGGGCCCAGGGCAAAAGG - Intergenic
945978220 2:216287103-216287125 TGGGGTGGGACCTGGAGAAGGGG - Intronic
946927841 2:224643477-224643499 TGGCATGGGCCCTGGACAATGGG + Intergenic
947642586 2:231715273-231715295 TGTGCTAGGCTCAGGACTAGGGG - Intergenic
948140559 2:235669791-235669813 TGCGCAGGGCCCAGGGCAGGCGG - Intronic
948338846 2:237232950-237232972 TGGACTGGGACAAGCACAAGTGG + Intergenic
948523933 2:238559026-238559048 TTGGATGGGCCCAGGACAGAGGG - Intergenic
1168829604 20:838384-838406 TGGGCTGGGTCCAGAACAGCCGG + Intronic
1169263641 20:4154871-4154893 TGGGCTGGGGGCAGGACAGAGGG + Intronic
1170630264 20:18058924-18058946 TCGGGTGCGCCCAGGACAACCGG + Intronic
1170796057 20:19547712-19547734 TGAGCTGGGCTCAGGGCAAGGGG - Intronic
1172097588 20:32467866-32467888 GGGGCCGGGCCAAGGAGAAGAGG + Intronic
1172127479 20:32633529-32633551 TGCTGTGGGCCCAGGACAGGAGG - Intergenic
1172273898 20:33669569-33669591 TGGGCTGGGCTCAGGATATAAGG - Intronic
1172503380 20:35443102-35443124 TGGGCTGGGAGCAGGGAAAGGGG + Intronic
1172875673 20:38163055-38163077 TGGGCTGGGCCGTGGGGAAGGGG - Intronic
1173665158 20:44757860-44757882 TGGGCTGGGAGCAGGGGAAGGGG - Intronic
1174041086 20:47699977-47699999 TAGGCAGGGCCCAGGACTGGTGG + Intronic
1174132903 20:48358616-48358638 TGGGTTTGTCACAGGACAAGGGG + Intergenic
1174297872 20:49561761-49561783 TGGGCTGTGCCAAGGATGAGGGG + Intronic
1174582100 20:51579374-51579396 AGGACTGGGCCCAGGGAAAGGGG + Intergenic
1175052587 20:56168933-56168955 TGGACAGGGGTCAGGACAAGTGG - Intergenic
1175424071 20:58853378-58853400 TGGGCTAGGCCCAGCACCGGGGG - Exonic
1176043677 20:63081461-63081483 TGTGCTGGGCACAGGGCTAGGGG + Intergenic
1176046661 20:63096472-63096494 TGGGCTTGTCCTGGGACAAGAGG - Intergenic
1176066889 20:63202530-63202552 GGGTCTGGTCTCAGGACAAGTGG - Exonic
1176109957 20:63406642-63406664 TGGGCCGGGCCCAGGAAGTGAGG - Exonic
1176110260 20:63407715-63407737 TGGGCTGGTCCCAGGAGGTGGGG + Intronic
1176301415 21:5100775-5100797 AGGGGTGGGCCCATGAGAAGCGG + Intergenic
1177332503 21:19681559-19681581 TGGGCTGGTCCCCAGACAAGAGG + Intergenic
1178517698 21:33262931-33262953 GAGGCAGCGCCCAGGACAAGTGG + Exonic
1179150212 21:38803528-38803550 AGGGCAGGACCCAGGGCAAGGGG + Intergenic
1179568149 21:42261889-42261911 TGGGCTGGGACCAGGTGAAGTGG - Intronic
1179610300 21:42545837-42545859 TGGGCTGTGCCCAGGACAGGAGG + Intronic
1179855616 21:44161124-44161146 AGGGGTGGGCCCATGAGAAGCGG - Intergenic
1180019464 21:45112467-45112489 TGGGCTGGGGCCAGGGCTTGGGG + Intronic
1181028272 22:20137931-20137953 CGGGCTGGGCCCTGGACAAGAGG + Intronic
1181147258 22:20858209-20858231 TGGGATGAGCCGAGGACCAGGGG - Intronic
1181581990 22:23833715-23833737 TGGGCAGAGCCCAGGACCACAGG - Intronic
1182021229 22:27083348-27083370 TGGGATGGGCCCAGCACCATTGG + Intergenic
1182524199 22:30905683-30905705 TGGGGTGGGCCCAAGGCCAGAGG + Intronic
1183540295 22:38426081-38426103 TGGGCTGGGCCCGGGGCTGGAGG + Intergenic
1184590334 22:45477716-45477738 TGGGCTGGGCCCTGGAGACATGG - Intergenic
1184656519 22:45944570-45944592 TGGGCTGGGCCCCTGAGATGAGG + Intronic
1184860257 22:47169425-47169447 TGGGCTGGGGCCAGGACAATGGG + Intronic
950176953 3:10881684-10881706 TGGGCCTGGGCCAGGACAAGTGG + Intronic
950398725 3:12753874-12753896 GGGCCTGGGCCCAGGGCAGGAGG + Intronic
950420722 3:12897554-12897576 GGTGCTGAGCACAGGACAAGAGG - Exonic
950427803 3:12934050-12934072 TCGGCTGTGCCCAGGAGCAGTGG + Intronic
950503059 3:13376582-13376604 TGGGCTGGGCCCTGGAACAGAGG + Intronic
950568450 3:13785719-13785741 TTGGGTGGGGGCAGGACAAGAGG - Intergenic
950705000 3:14773957-14773979 TGCGCTGGGCCCACGACACTGGG + Intergenic
951635018 3:24764287-24764309 TGGGGTGGGCGTAGGAGAAGAGG - Intergenic
952535441 3:34304433-34304455 GGGACTGGGGCCAGGACAAGGGG + Intergenic
953879193 3:46682961-46682983 TGGGCCAGGCCCAGTCCAAGAGG + Intronic
954147444 3:48641328-48641350 TGGGCCGGGCCCAGCGCCAGAGG - Exonic
954370330 3:50166713-50166735 GGGGCTGGGCCCAGGGGAGGGGG + Intronic
954712729 3:52513046-52513068 GGGGCTGGGCCCACCCCAAGGGG - Intronic
959122008 3:102243730-102243752 TGGGTGGGACCAAGGACAAGGGG + Intronic
959776596 3:110171807-110171829 TTAGCTTAGCCCAGGACAAGGGG - Intergenic
961390894 3:126551761-126551783 TGGGCAGGGCCCAGGCCACCGGG - Intronic
961458430 3:127035729-127035751 TGGGCCTGGCCAAGGACATGGGG - Exonic
962277579 3:134028002-134028024 AGGGCTGGGCTCAGGCCAATTGG - Intronic
962405198 3:135094451-135094473 GGGGCTGGGCCGTGGACAGGAGG + Intronic
962533027 3:136301234-136301256 TAGGGTGGGCACAGGACCAGTGG + Intronic
962895394 3:139709386-139709408 AGGGCTGGGCTCAGGAAATGTGG + Intergenic
962898178 3:139734696-139734718 TGTGCTGGGCCCAGGAAACAGGG + Intergenic
964084538 3:152800056-152800078 TGGGAATGGCCAAGGACAAGTGG - Intergenic
964414017 3:156428761-156428783 TGGGCTGTTCGCAGGTCAAGAGG + Intronic
964790602 3:160450419-160450441 TGGGCTGAGCACAGGAGAAGGGG + Intronic
965118392 3:164520534-164520556 TGAACTGGGCCCAGAGCAAGTGG - Intergenic
965415261 3:168384871-168384893 TGGGCTGGGCTTAGAACCAGTGG - Intergenic
966739346 3:183217722-183217744 TGGGGAGGGCCAGGGACAAGTGG - Intronic
966815168 3:183884616-183884638 TGAGCTGGGGCCAGCACAAGAGG + Intronic
966911979 3:184564823-184564845 TGGGCTGTGACCAGGATATGTGG + Intronic
967085407 3:186090804-186090826 AGGGCTGGGATCAGGACGAGAGG + Intronic
968017948 3:195356442-195356464 TGGGCTGGGCTCAGAGCCAGTGG + Intronic
968023680 3:195419236-195419258 AGGGCTGGGCGCAGGGAAAGAGG - Intronic
968551155 4:1223917-1223939 AGTGCTGGGCCCAGGATAGGCGG + Intronic
969316971 4:6388236-6388258 TGTGCTGTGCCCAGCACCAGGGG - Intronic
969567082 4:7984950-7984972 TGGGCAGGGACCAGGAGATGTGG + Intronic
969713513 4:8857812-8857834 TGGGCAGGGGCAAGGGCAAGGGG - Intronic
969817772 4:9698927-9698949 AGGGCGGGGCCCAGGACCACAGG - Intergenic
969842689 4:9893928-9893950 TGATCTGGGCCCAGGATCAGAGG + Intronic
969971261 4:11050767-11050789 TGAGGTGGGCCCAGGATAACAGG + Intergenic
970994851 4:22253837-22253859 GGGTCTGGGCACAGGAAAAGGGG + Intergenic
971184241 4:24358430-24358452 TGGGCTGGGGCCAGAACACCTGG - Intergenic
972158979 4:36199084-36199106 TGGCGTGAGCCAAGGACAAGTGG - Intronic
972914151 4:43855224-43855246 TGGGATGGGAGCAGGACAAAAGG - Intergenic
973339276 4:48986926-48986948 TGGGCTGGGCCCAGGACAAGTGG + Intronic
975517824 4:75266662-75266684 TGAGCTAGGCCCAAGGCAAGAGG - Intergenic
976451959 4:85200174-85200196 TGAACTGGGCCCAGGAACAGTGG - Intergenic
976814627 4:89133223-89133245 AGAGCTGGGCCTAGGGCAAGGGG + Intergenic
977074297 4:92433285-92433307 TGTGCTGGGCCCAGAGCCAGTGG - Intronic
978560796 4:110031579-110031601 TGGGCTGGGGCCAGAGCAGGTGG + Intergenic
978923671 4:114217155-114217177 TGGGGAGGGCCCAGGCCAACTGG - Intergenic
979184561 4:117772333-117772355 TGTGCTGGGCTCAGAACCAGTGG + Intergenic
986801117 5:11261282-11261304 TGGTCTTGCCCCAAGACAAGGGG + Intronic
987076034 5:14382542-14382564 AGGGCAGGGCGCAGGACCAGGGG + Intronic
988384117 5:30539408-30539430 TGTGCTGGGCCCAGAGCCAGAGG + Intergenic
990579126 5:57151235-57151257 TGCGCTGGGCCCAGATCCAGTGG - Intergenic
992994130 5:82315887-82315909 TGGGCTGGGACCATGGCAAAGGG + Intronic
994274780 5:97822541-97822563 TGGGCTGGGCTCAGAGCCAGAGG - Intergenic
994881156 5:105498281-105498303 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
995787457 5:115844706-115844728 TGTGCTGGGCCTAGAACAAGGGG - Intronic
995916754 5:117255964-117255986 TGGGATGGGTCTAGGGCAAGGGG + Intergenic
996852791 5:127971280-127971302 TCTGCTTGGCCTAGGACAAGTGG - Intergenic
997641529 5:135451812-135451834 CAGGCTGAGCCCAGGACAGGTGG + Intronic
998291275 5:140916826-140916848 TGGGCTGGGCTCAGAACCAGAGG - Intronic
998525613 5:142840604-142840626 TGGGGAGGGCCCATGGCAAGTGG + Intronic
999153727 5:149443096-149443118 TGGGCTGGTCCTAGGAGCAGTGG + Intergenic
999154709 5:149450154-149450176 TGGCCTGGACCCAGGACCTGGGG - Intergenic
999367988 5:151035266-151035288 TGGTCTGTGCACAGGTCAAGAGG + Intronic
999730838 5:154475870-154475892 TCGACTGGGCCCAGGGCAGGAGG + Exonic
1001211687 5:169815757-169815779 TGTGCAGGGGCCAGGACTAGGGG - Intronic
1001713217 5:173794498-173794520 TGGGCTGGGCCCTGCAGTAGCGG + Intergenic
1002293607 5:178215753-178215775 GGGTCTGGGCCCAGGAGATGGGG - Intronic
1002582301 5:180216156-180216178 TTGGCTGGGCTCAGGACCACTGG - Intergenic
1002952899 6:1833079-1833101 TGAGCTGGGCACAGGTCCAGCGG - Intronic
1003161486 6:3638225-3638247 TGGGCTGGGAGCAGGGCAGGGGG + Intergenic
1003171320 6:3724003-3724025 GGTGCTGGGCACAGAACAAGAGG - Intronic
1004753670 6:18588532-18588554 TTGGGTAGGCCCAGAACAAGTGG + Intergenic
1005674098 6:28136776-28136798 TGAGCTGGGCCCTGGGCCAGAGG - Intergenic
1006173683 6:32109453-32109475 TGGGGTGGGGGCAGGAGAAGAGG - Intronic
1006364454 6:33607248-33607270 TTGGCTGGGAGCAGGACAGGTGG + Intergenic
1006497680 6:34435535-34435557 TTGCCTGGGCCCAGGACTAGGGG - Intergenic
1006653301 6:35569039-35569061 CTGGCTGGGCCCAGGGCAAGAGG + Intergenic
1007190429 6:40011905-40011927 TGTGCTGGGCTCAGAACCAGTGG - Intergenic
1007336298 6:41157363-41157385 TGGACTGGGCCCCAGAGAAGTGG - Intergenic
1007373615 6:41442410-41442432 TGGGCTGGGGCCAGGACCTGAGG - Intergenic
1007409152 6:41651773-41651795 TGTGCTGGGGCCAGGCCATGGGG - Intronic
1007834686 6:44665409-44665431 TGGGCTGGGCTAAGGGCAAGTGG + Intergenic
1008801255 6:55370971-55370993 TGGGCAGGGCCCAGCATCAGAGG - Intronic
1008886627 6:56438032-56438054 GGGACTGGGCCTAGGACATGAGG - Intergenic
1009781708 6:68279946-68279968 TGGGCTGGGCTCAGAGCCAGTGG + Intergenic
1009902129 6:69820555-69820577 TGGCCTGGGCCCAGGACATGTGG - Intergenic
1015955434 6:138593260-138593282 TGGACTGGGGCAAGGACAACGGG - Intronic
1016041565 6:139437077-139437099 TGGGCATGGCCCAGGGCAGGTGG - Intergenic
1016806374 6:148216520-148216542 TGGGCTGGAGTCAGGACATGTGG + Intergenic
1017205760 6:151803345-151803367 TGGGCTGGACCTATTACAAGAGG + Intronic
1017761882 6:157575533-157575555 TGTCCTGGTCCCAGGACAGGAGG - Intronic
1018206814 6:161444168-161444190 TGGGATGGGTCCTGGAGAAGTGG - Intronic
1018519493 6:164631440-164631462 TTGCGTGGGCCCAGGAAAAGTGG + Intergenic
1019329468 7:455488-455510 TGGGCTGGACGCAGGACGTGGGG + Intergenic
1019447861 7:1080870-1080892 GGTGCAGGGCCCAGGCCAAGCGG - Intronic
1019603108 7:1895114-1895136 CGAGCTGGGCCCAGGTGAAGAGG + Intronic
1020111780 7:5451767-5451789 TGGGCTCAGCCCTGGACACGTGG - Intronic
1024000062 7:45184047-45184069 TGGGCTGTGTCCATGACCAGAGG + Exonic
1025743864 7:64225910-64225932 TGGGCAGGGCCCAGAAAAAAAGG + Intronic
1026735059 7:72944065-72944087 GGGGGTGGGCACAGCACAAGTGG + Intronic
1026785401 7:73298991-73299013 GGGGGTGGGCACAGCACAAGTGG + Intergenic
1027108673 7:75420942-75420964 GGGGGTGGGCACAGCACAAGTGG - Intronic
1028354393 7:89888089-89888111 TGGGCTGGGCTCAGAGCCAGAGG - Intergenic
1029109410 7:98204886-98204908 TGGGCTGGTCCCAAGTCCAGGGG - Intronic
1029184974 7:98731844-98731866 TGGGCCTGGCCCAGGCCCAGGGG + Intergenic
1029365647 7:100114427-100114449 TGGGCTGGGGCCAGGTTCAGTGG + Intronic
1035334912 7:158121608-158121630 AGGGCTGGGCCCAGGATTCGTGG - Intronic
1035592182 8:824573-824595 AGGACTGGGGCCAGGACAAGGGG - Intergenic
1035842949 8:2832227-2832249 TGGGCTGGACTCAGGGTAAGAGG + Intergenic
1036545847 8:9768890-9768912 TGTGCTGGATCCAGGACAACTGG - Intronic
1036570247 8:9974082-9974104 TGGCCTGGGCACAGGGCCAGAGG + Intergenic
1036664532 8:10730254-10730276 TGGTTTGGGCCAAGGACGAGAGG - Intronic
1037670814 8:21013639-21013661 TGGGCTGGCCCCCTGACAACAGG + Intergenic
1037755408 8:21706924-21706946 TGGCCAGGGCCCAGGGCAGGAGG - Intronic
1037882787 8:22581015-22581037 CAGCCTGGGCCCAGGTCAAGAGG - Intronic
1038985401 8:32803700-32803722 TGGACTGGGCTCAGGATTAGAGG + Intergenic
1039458925 8:37727306-37727328 AGAGCTGGGCCCAGGAGGAGGGG + Intergenic
1039702670 8:39978332-39978354 TGGGCTGGGGCGAGGGGAAGAGG + Intronic
1040485654 8:47869134-47869156 TGGGCTGGGCTCAGAACAAGTGG + Intronic
1040538062 8:48326965-48326987 TGCACTGGGCCCAGGACCCGGGG + Intergenic
1041329603 8:56710510-56710532 TGGGATGGGCCCAGCACCTGTGG + Intergenic
1043502831 8:80873902-80873924 GGGGCCGGGCCCGGGACAGGGGG + Intronic
1048985291 8:139731705-139731727 GGAGCTGTGCCCAGGACAGGGGG - Intronic
1049241463 8:141539448-141539470 CGGGCTGTGCCCAGCAGAAGAGG + Intergenic
1049379751 8:142306029-142306051 AGGGCAGGGGCCAGGGCAAGAGG + Intronic
1049399026 8:142416589-142416611 AGGGCTGGGCCCAGGACAGCTGG + Intergenic
1049434520 8:142580190-142580212 TGGGCTGGCCACAGGGCAAGGGG - Intergenic
1049709546 8:144057405-144057427 AGGGCTGGGGGCAGGACAGGCGG + Intronic
1049815729 8:144598441-144598463 GTGGCTGGGCACAGGACAGGAGG + Intronic
1049850787 8:144829153-144829175 GGGTCTGGGCCCAGGGCCAGTGG - Intronic
1052854908 9:33401183-33401205 TGGGCTGGGTGAAGGACAGGGGG + Intronic
1053311782 9:37025141-37025163 TGGGCTGGGACCAGAACAGGGGG + Intronic
1053682930 9:40497512-40497534 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1053932911 9:43125826-43125848 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054280784 9:63127416-63127438 TGGGCTGGGTGGAGGACAGGGGG - Intergenic
1054296030 9:63333012-63333034 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054394046 9:64637507-64637529 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054428695 9:65142719-65142741 TGGGCTGGGTGGAGGACAGGGGG + Intergenic
1054501684 9:65878823-65878845 TGGGCTGGGTGGAGGACAGGGGG - Intronic
1055301953 9:74891643-74891665 TGAGCTGGGCTCAGACCAAGTGG + Intergenic
1055632583 9:78238591-78238613 AGGGCCGGGCACACGACAAGTGG - Intronic
1056947789 9:91014429-91014451 TTGGCTGCCACCAGGACAAGAGG + Intergenic
1057042470 9:91857619-91857641 TAGGCAGGACCCAGGACGAGGGG + Intronic
1057419796 9:94902067-94902089 TGGTCTGTGACCAGGACCAGTGG - Intronic
1059452783 9:114381241-114381263 GGGCCTGGGCCGAGGACAAGAGG - Exonic
1060245161 9:121939778-121939800 TGGGCTGGGTGCAGGAAATGGGG - Intronic
1060247583 9:121959211-121959233 TGGGGTGAACCCAGGACAGGAGG - Intronic
1060886799 9:127160356-127160378 TGGGCTGGCCTCAACACAAGGGG - Intronic
1061186713 9:129059273-129059295 TGAGCTGGGCCCAGTGCAGGTGG + Intronic
1061237255 9:129350368-129350390 AGGGCTTGTCCCAGGTCAAGTGG - Intergenic
1062232584 9:135490371-135490393 CCTGGTGGGCCCAGGACAAGGGG - Intergenic
1062266628 9:135689517-135689539 CAGGCAGGGCCCAGGGCAAGGGG + Intergenic
1062530184 9:136996273-136996295 TGGGCTGGGCCCAGGAGCCAAGG + Intronic
1203759691 EBV:5742-5764 AGGGCTGGGCCCGGGGCTAGGGG - Intergenic
1188027542 X:25226365-25226387 TGGGCTGGGCTCAGAGCCAGAGG + Intergenic
1189733354 X:44045110-44045132 TTTCCTGGGCCCAGGGCAAGAGG + Intergenic
1190275090 X:48894066-48894088 GGGGCTGGGGCCAGGGCCAGGGG + Intronic
1190588210 X:51968241-51968263 TGGGCTGGGCCCAGAGCCAGAGG - Intergenic
1192013440 X:67300090-67300112 TGGGCTGGACCTAGGACATACGG - Intergenic
1192360239 X:70434579-70434601 AGGGGTGGGCCCGGGAGAAGGGG - Intergenic
1193453924 X:81705711-81705733 AGGGCTAGAACCAGGACAAGTGG + Intergenic
1194223556 X:91227028-91227050 TGAACTGGGCCCAGAACCAGAGG + Intergenic
1194288608 X:92040210-92040232 TGGGCTGGGCCTAGAGCCAGGGG - Intronic
1195331769 X:103808735-103808757 TGAGCTGGGGCCAGGGCAAGAGG + Intergenic
1195601266 X:106751529-106751551 TGTGCTGGGCTCAGAACCAGAGG + Intronic
1196231134 X:113223314-113223336 TGGTCTGGGGACAGGACATGTGG + Intergenic
1196243095 X:113366409-113366431 TGGGCTGGGCTTAGTACCAGTGG - Intergenic
1197594791 X:128451823-128451845 GAGGCTGGGTCCAGGACAAAGGG - Intergenic
1197710464 X:129663160-129663182 TGGGCTGGGGGCAGGAACAGAGG - Intergenic
1198862776 X:141088690-141088712 TGAACTGGGCCCAGAACCAGTGG + Intergenic
1198899917 X:141498696-141498718 TGAACTGGGCCCAGAACCAGTGG - Intergenic
1199903934 X:152206099-152206121 TGGGCAGTGCCCAGGACAGACGG + Intronic
1200158659 X:153992807-153992829 TGGCTTGAGCCCAGGACAACTGG - Intergenic
1200560022 Y:4690410-4690432 TGAACTGGGCCCAGAACCAGAGG + Intergenic
1200606129 Y:5264775-5264797 TGGGCTGGGCCTAGAGCCAGGGG - Intronic
1202265098 Y:23009860-23009882 TTGGCAGAGCCCAGGACAAAGGG - Intergenic
1202418089 Y:24643602-24643624 TTGGCAGAGCCCAGGACAAAGGG - Intergenic
1202452697 Y:25026484-25026506 TTGGCAGAGCCCAGGACAAAGGG + Intergenic