ID: 973343184

View in Genome Browser
Species Human (GRCh38)
Location 4:49027030-49027052
Sequence GCCACTCTAGTGCCTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973343182_973343184 21 Left 973343182 4:49026986-49027008 CCAATTTACATTCTCATGCTGAT 0: 1
1: 0
2: 2
3: 19
4: 226
Right 973343184 4:49027030-49027052 GCCACTCTAGTGCCTCAAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973343184 Original CRISPR GCCACTCTAGTGCCTCAAGC AGG Intronic
900225883 1:1533481-1533503 ACCACTCATGTGCCTCAAGGTGG + Intronic
900312351 1:2040016-2040038 GCCACTCTAGAAGCTCAAGATGG - Intergenic
904512474 1:31023815-31023837 GCCACTCAAGAGGCTGAAGCAGG + Intronic
906614474 1:47225275-47225297 GTGGCTCTAGAGCCTCAAGCTGG - Intronic
908644143 1:66258966-66258988 ACCACTGAAATGCCTCAAGCTGG - Intronic
910999812 1:93151263-93151285 GCCACTCTTCTACCACAAGCTGG - Exonic
912279253 1:108296132-108296154 CCCACTCTCCTTCCTCAAGCAGG + Intergenic
912288973 1:108398225-108398247 CCCACTCTCCTTCCTCAAGCAGG - Intronic
915717596 1:157959164-157959186 TCTACTCTAGCCCCTCAAGCAGG - Intergenic
917059929 1:171026384-171026406 GCTACTCTAGAGGCTGAAGCAGG - Intronic
919109477 1:193199599-193199621 GCTACTTGAGTGGCTCAAGCAGG + Intronic
921421015 1:214948282-214948304 GGCAGTCTAGTCCCCCAAGCAGG + Intergenic
922869111 1:228885813-228885835 GCTACTCTGGAGCCTGAAGCAGG + Intergenic
923515632 1:234695729-234695751 GCCACTCTGGTGCCCCAGGATGG - Intergenic
923678854 1:236102803-236102825 GCCCCTCCAGTGCCTCAGCCAGG - Intergenic
1065261193 10:23925327-23925349 GCCTCTCTAGTGCCTAACCCAGG - Intronic
1067141158 10:43658440-43658462 GCCACTGAAAGGCCTCAAGCAGG - Intergenic
1067267765 10:44761352-44761374 GCAACTCTGGTGCCTGAGGCTGG - Intergenic
1069469920 10:68678636-68678658 GCTACTCAAGTGCCTGAGGCAGG + Intronic
1071456659 10:85856390-85856412 CCCACTCTAGTTCCTGAGGCAGG - Intronic
1075939827 10:126381440-126381462 CTCACTCTATTGCCTCAGGCTGG - Intronic
1079627469 11:22633707-22633729 GCCACTGTAGTTCCCCAACCAGG + Intronic
1082927803 11:58569498-58569520 GCCACTCAGGTGGCTGAAGCAGG - Intronic
1086479948 11:87223736-87223758 GCCACTCTGGAGGCTGAAGCAGG + Intronic
1088493383 11:110408110-110408132 GCTACTCGAGTGGCTGAAGCAGG - Intergenic
1092710035 12:11326271-11326293 GCCACTCAAGAGTCTGAAGCTGG - Intergenic
1095447078 12:42293243-42293265 GCCACTCTGGAGCCTGAGGCAGG + Intronic
1096615347 12:52829787-52829809 GCTACTCCAGTGGCTAAAGCAGG + Intronic
1097792902 12:63833596-63833618 GCAACTCTCGTGCCTCAGCCAGG - Intergenic
1098524835 12:71475389-71475411 GCCACTCTAGGACTTTAAGCAGG - Intronic
1100976494 12:100127899-100127921 GCTACTCTGGTGGCTGAAGCAGG + Intronic
1102368718 12:112362811-112362833 GCTACTCTAGAGGCTCAGGCAGG - Intronic
1103040907 12:117694878-117694900 CTCACTCTGTTGCCTCAAGCTGG + Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1105491776 13:20895064-20895086 GCTACTCTAGAGGCTGAAGCAGG + Intronic
1106514147 13:30438512-30438534 GCCACTGTAATTTCTCAAGCAGG - Intergenic
1107855328 13:44609748-44609770 GCCACTCTAGAGTCTTAAGAGGG + Intergenic
1108744379 13:53376613-53376635 GGCTCTCTAGTGCATCAAGAAGG - Intergenic
1114547591 14:23513882-23513904 ACCACTTTACTTCCTCAAGCTGG - Intergenic
1116915076 14:50517261-50517283 GCTACTCTAGGGCCTGAGGCAGG - Intronic
1117263977 14:54066487-54066509 TCAAATCTAGTGCCTTAAGCTGG + Intergenic
1117310100 14:54512702-54512724 GCCACAATAGTGCCTCACTCTGG + Intronic
1117890757 14:60419387-60419409 GCCACTCAAGAGGCTGAAGCAGG + Intronic
1123676017 15:22710829-22710851 GCCACTCAAGAGGCTGAAGCAGG - Intergenic
1123693424 15:22858587-22858609 GCCACTCTAGTGACTCCACTAGG + Exonic
1125696223 15:41639654-41639676 GCTACTCTAGTGGCTGAGGCAGG - Intronic
1125948087 15:43726849-43726871 GCCACTCTAGAGCCTGAGGCAGG - Intergenic
1126102983 15:45130494-45130516 ACCACTCTAGGGCTTCAGGCTGG + Intronic
1128218874 15:65953752-65953774 GCCAATCCAGAGCCCCAAGCAGG + Intronic
1129114230 15:73356297-73356319 GCCACTCCAGAGACTCAAGCAGG - Intronic
1133351319 16:5102591-5102613 TTCACTCTTGTGCCCCAAGCCGG + Intergenic
1133945507 16:10344540-10344562 GCCACTCTGGTGGCTGAGGCAGG + Intronic
1134481494 16:14623400-14623422 GCCACTCCAGAGGCTCAGGCAGG + Intronic
1134842698 16:17414440-17414462 GCCACTCCAGAGGCTAAAGCTGG - Intronic
1135432676 16:22399809-22399831 GCTACTCTAGTGGCTGAGGCAGG + Intronic
1136371406 16:29838795-29838817 CTCACTCTACTGCCTCAGGCTGG - Intronic
1138575260 16:57903629-57903651 GCCCCTGAAGTGCCTCTAGCAGG - Intronic
1138904757 16:61317864-61317886 GCTACTCTAGAGGCTGAAGCAGG - Intergenic
1138990833 16:62388931-62388953 GCTACTCAAGTGACTGAAGCAGG + Intergenic
1142396031 16:89832110-89832132 GCCCCTCTCTTGCCTCACGCGGG - Intronic
1142775363 17:2133647-2133669 GCTACTCTAGAGGCTGAAGCAGG - Intronic
1145035686 17:19539018-19539040 GCCACTCAGGAGCCTGAAGCAGG - Intronic
1146956605 17:36939695-36939717 GCCACGCTCTTGCCTAAAGCGGG - Intronic
1146988637 17:37246542-37246564 GCCACTCTGGTGTCTAAGGCGGG - Intronic
1147334966 17:39722028-39722050 GCCACTCTGGAGGCTGAAGCAGG - Intronic
1150468272 17:65413972-65413994 GCCATTCTCCTGCCTCTAGCTGG - Intergenic
1151210508 17:72540622-72540644 GCCACTCCAGGGCCTGAGGCAGG + Intergenic
1151302696 17:73239628-73239650 GCTACTCTGGAGCCTGAAGCAGG - Intronic
1151705003 17:75762842-75762864 GCCACTCTCGGACCCCAAGCTGG - Exonic
1151908158 17:77062982-77063004 GCCACTCCAGAGGCTCAGGCAGG - Intergenic
1151994154 17:77598045-77598067 GCCTCTCTGGGGCCTCCAGCTGG + Intergenic
1154284221 18:13036556-13036578 GCGATTCTGATGCCTCAAGCAGG + Intronic
1156805706 18:41177373-41177395 GCTACTCTAGAGACTGAAGCAGG + Intergenic
1156928085 18:42607352-42607374 GCTACTCTAGAGGCTGAAGCAGG - Intergenic
1157015741 18:43710818-43710840 CTCACTCTTGTCCCTCAAGCTGG + Intergenic
1158867281 18:61649917-61649939 GTCACTCTAGTCGCTCAGGCTGG - Intergenic
1159281911 18:66296553-66296575 GCCACTCTGGTGTCTGAGGCAGG - Intergenic
1161488796 19:4550473-4550495 GCCACTCGGGTGGCTGAAGCAGG - Intronic
1162926312 19:13932046-13932068 GCTCCTCTAGGGCCTCAGGCAGG + Intronic
1163085627 19:14977667-14977689 GCCACTCAAGAGGCTAAAGCAGG + Intronic
1163141266 19:15350457-15350479 GCTACTCTAGAGGCTGAAGCAGG - Intergenic
1163451869 19:17383030-17383052 GCTACTCTAGAGGCTGAAGCAGG - Intergenic
1164452877 19:28381842-28381864 GCCACTCAAGAGCCTGAGGCTGG + Intergenic
1167380500 19:49135482-49135504 GCCACTCTAGAGGCTGAGGCAGG - Intronic
1167516462 19:49926095-49926117 GCTACTCTGGAGCCTGAAGCAGG + Intronic
1167624130 19:50575840-50575862 GCTACTCTGGTGCCTGAAGCAGG + Intergenic
1167728743 19:51237039-51237061 GCCACTCAATCACCTCAAGCAGG + Intronic
925373500 2:3364521-3364543 GCCACTCTAGGGCCTGAGGTGGG + Intronic
926303919 2:11623783-11623805 GCGACTCTCCTGCCTCAGGCTGG - Intronic
928162722 2:28943247-28943269 GCTACTCTAGAGGCTGAAGCAGG - Intronic
930009953 2:46929131-46929153 CCCACTCTATTGCCCCAGGCTGG - Intronic
930726187 2:54683852-54683874 ACCACTCTATTGCCTCAGGGTGG + Intergenic
935751572 2:106239525-106239547 GCTACTCTGGAGGCTCAAGCAGG + Intergenic
936339397 2:111617985-111618007 GACACTCCAGTGCCACAGGCTGG - Intergenic
936460365 2:112709907-112709929 GCCTCTCTATTGGGTCAAGCTGG - Intergenic
938318170 2:130344222-130344244 GCCATTCTCCTGCCTCAGGCTGG - Intronic
939309399 2:140454908-140454930 GCCACTGTAGTGACTCAGGCAGG + Intronic
942528399 2:176881197-176881219 GCTACTCAAGTGGCTAAAGCAGG + Intergenic
944829038 2:203513954-203513976 GCCACTCTGGAGGCTCAGGCAGG - Intronic
947198826 2:227596577-227596599 GCTACTCTAGAGCCTCAGACAGG + Intergenic
947967087 2:234290647-234290669 GCCACTCTAGGGCCCCGACCTGG - Intergenic
948674487 2:239588962-239588984 GCCACTCTACGGGCTCCAGCTGG + Intergenic
948850756 2:240704248-240704270 GCCACTCAGGTGGCTCCAGCAGG + Intergenic
948865417 2:240772500-240772522 GCCACCCTAGGCCCTCATGCTGG + Intronic
948890305 2:240904164-240904186 GCCACTCTGGAGGCTGAAGCAGG + Intergenic
1169932795 20:10852559-10852581 GCCAGTCTGTTGCCTTAAGCAGG + Intergenic
1172521560 20:35569997-35570019 GCGATTCTCCTGCCTCAAGCTGG - Intergenic
1172680727 20:36712505-36712527 GCTACTCAAGTGGCTGAAGCAGG - Intronic
1173178304 20:40782288-40782310 GTCCCTGTAGTCCCTCAAGCCGG - Intergenic
1174507850 20:51028249-51028271 GCTAGTCTAGTGACACAAGCTGG - Intergenic
1175487155 20:59354699-59354721 GCCACTCTAGTGCAGGAGGCAGG + Intergenic
1175733681 20:61371157-61371179 GCCACTCTAGAGCCTTCTGCAGG - Intronic
1176363309 21:6016741-6016763 GCCACTCTGCTGCCACCAGCAGG + Intergenic
1178522343 21:33296834-33296856 GCTACTCGAGTGCCTGAGGCAGG + Exonic
1179234241 21:39530911-39530933 GCCACTCTGGAGGCTCAGGCAGG + Intergenic
1179760209 21:43521804-43521826 GCCACTCTGCTGCCACCAGCAGG - Intergenic
1180641580 22:17303605-17303627 GGCACTCCAGTGCAGCAAGCTGG + Intergenic
1183992359 22:41606242-41606264 GCCACTCAGGTGGCTCAAGTGGG + Intronic
1184021622 22:41825388-41825410 GCCACTCTACTCCCTCACCCTGG + Intronic
953152834 3:40340886-40340908 TCCACCCTCTTGCCTCAAGCTGG - Intergenic
954302364 3:49706686-49706708 GGCCCTCTAGTGCCTGGAGCAGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955076217 3:55616035-55616057 TTCACTCTAGTGTCTCAGGCTGG + Intronic
962613211 3:137098572-137098594 GCCACTCTACTTCTTCCAGCTGG - Intergenic
964599064 3:158475024-158475046 GCTACTCTAGAGGCTGAAGCAGG - Intronic
966552130 3:181216864-181216886 GCCATTCTCCTGCCTCAGGCTGG + Intergenic
971522300 4:27569264-27569286 GCTACTCTAGAGGCTGAAGCAGG - Intergenic
971619014 4:28829892-28829914 GCTACTCTAGAGGCTGAAGCAGG + Intergenic
972534267 4:39986486-39986508 GCTACTCTGGAGCCTGAAGCAGG - Intergenic
972659750 4:41104649-41104671 GCCACTCTCCTCCCTCAAGTGGG + Intronic
973343184 4:49027030-49027052 GCCACTCTAGTGCCTCAAGCAGG + Intronic
975203957 4:71623486-71623508 GCTACTCTGGTGCCTGAGGCAGG - Intergenic
976367939 4:84251094-84251116 GCCACCCTCTTCCCTCAAGCAGG - Intergenic
979800310 4:124899891-124899913 GCCACTCTTGAGACTCAAGCAGG - Intergenic
982246351 4:153356058-153356080 GCCACTCTGGAGGCTGAAGCGGG + Intronic
983362190 4:166740635-166740657 GCTACTCTGGCGCCTGAAGCAGG - Intronic
989169889 5:38463742-38463764 GCCATTCAAGTGCCCCAAACTGG + Intronic
989582226 5:43043534-43043556 GCTACTCTAGAGGCTGAAGCGGG - Intergenic
991229140 5:64310748-64310770 GCCACTCATCTGCCTCAATCTGG + Intronic
991981581 5:72237029-72237051 GCTACTCTAGAGGCTCAAGTAGG - Intronic
992044066 5:72867068-72867090 GCTACTCTGGAGGCTCAAGCAGG + Intronic
992462609 5:76975690-76975712 GCCACTCTGGAGGCTGAAGCAGG + Intronic
992682390 5:79166036-79166058 GCTACTCTAGAGGCTGAAGCAGG + Intronic
993498663 5:88638598-88638620 GCTACTCTGGTGGCTGAAGCAGG + Intergenic
994435183 5:99720587-99720609 CCCACTCTTCTGCCTCAAGTAGG - Intergenic
995389252 5:111621796-111621818 GCTACTCTGGAGCCTGAAGCAGG - Intergenic
997623769 5:135318145-135318167 GCCCCTCTAGTCCCTGAGGCTGG - Intronic
1000527306 5:162373435-162373457 GCCACTCAAGAGCCTGATGCAGG - Intergenic
1000887045 5:166759128-166759150 GCCACTCGAGTGGCTGAGGCAGG + Intergenic
1001273762 5:170335371-170335393 GCTACTCTAGAGGCTGAAGCAGG + Intergenic
1007205409 6:40145951-40145973 GCCATCCTAGTGAATCAAGCAGG - Intergenic
1007734269 6:43970894-43970916 CCCACACCAGGGCCTCAAGCTGG + Intergenic
1013556138 6:111259265-111259287 ACCGCTATCGTGCCTCAAGCCGG - Intergenic
1015544336 6:134346471-134346493 CTCACTCTATTGCCCCAAGCTGG - Intergenic
1015601503 6:134915391-134915413 TCTACTCTAGTGTCTCCAGCAGG + Intergenic
1016182614 6:141165857-141165879 GCTAATATAGTGACTCAAGCAGG - Intergenic
1018257371 6:161935239-161935261 TCCTCTTTAGTGCCTCAAACTGG - Intronic
1019287101 7:229073-229095 GCCACTCTAGGACCAGAAGCAGG + Exonic
1021499062 7:21309410-21309432 GCTACTCTAGAGGCTAAAGCAGG - Intergenic
1024430273 7:49280594-49280616 CCTACTCTAGAGGCTCAAGCAGG - Intergenic
1024518681 7:50283917-50283939 GCCCCTCTCCTGCCTCCAGCAGG + Intergenic
1027159583 7:75792492-75792514 GCTACTCAAGAGGCTCAAGCGGG + Intergenic
1029149467 7:98469962-98469984 GCCACTCTCGGGGCTGAAGCAGG - Intergenic
1029272397 7:99385067-99385089 GCCATTCTCCTGCCTCAGGCTGG + Intronic
1030206895 7:106959941-106959963 GCCACTCTAGAGGCTGGAGCTGG - Intergenic
1030884234 7:114919394-114919416 GCCACTCTAGAGGCTGAAGCGGG - Intergenic
1030924683 7:115437542-115437564 GCCATTCTCCTGCCTCAGGCTGG + Intergenic
1032204157 7:129847156-129847178 GCTACTCTAGAGCTTGAAGCAGG - Intronic
1036946292 8:13098111-13098133 GCCACTCTGGAGCCTCAGGTGGG + Intronic
1037769997 8:21792953-21792975 GCTACTCGAGTGCCTGAGGCAGG + Intronic
1041389745 8:57337986-57338008 GAAGCTCTAGTGCCTCAAGTGGG + Intergenic
1041499704 8:58527186-58527208 GTCACTCCAGTGGCTCCAGCCGG - Intergenic
1042448971 8:68922637-68922659 CCCACTCTAGTCCCTGAAGCTGG + Intergenic
1043497678 8:80820792-80820814 GCTACTCTAGAGCCTGAGGCAGG + Intronic
1048574702 8:135681416-135681438 GCCACTTTGGGGCCTCAAGCTGG - Intergenic
1053596143 9:39563661-39563683 GCTACTCTAGAGGCTGAAGCAGG - Intergenic
1053854112 9:42320302-42320324 GCTACTCTAGAGGCTGAAGCAGG - Intergenic
1054570113 9:66801357-66801379 GCTACTCTAGAGGCTGAAGCAGG + Intergenic
1056582124 9:87896789-87896811 GCTACTCTAGTGGCTGAGGCAGG + Intergenic
1057284539 9:93740483-93740505 GCCACTCTAGAGGCTGAGGCAGG + Intergenic
1057460044 9:95252944-95252966 GCTACTCTAGAGGCTGAAGCAGG + Intronic
1059040967 9:110815153-110815175 GCCACTCTGGAGGCTGAAGCAGG + Intergenic
1059807940 9:117824892-117824914 GCCACTGTCGTGCCTGATGCTGG - Intergenic
1059816881 9:117926658-117926680 CCCACTCTACTCCCTCCAGCTGG - Intergenic
1061777688 9:132976828-132976850 GCCACTCAAGAGGCTGAAGCAGG + Intronic
1062457643 9:136646979-136647001 GCCTCTCTGGGACCTCAAGCAGG - Intergenic
1185452131 X:288302-288324 CCCACTCTAGAGCCTCTAGAAGG - Intronic
1186779621 X:12899734-12899756 GCGACTCTAGGGCATCAACCAGG + Intergenic
1190479877 X:50865538-50865560 TCCACAAGAGTGCCTCAAGCAGG + Intergenic
1193777459 X:85660893-85660915 TCCACTCTCCTGTCTCAAGCAGG - Intergenic
1196058012 X:111377058-111377080 GCCTCTTTAGTGCCTCAGGCAGG - Intronic
1196206912 X:112950507-112950529 GACACTCTAGTGCTTAAGGCAGG + Intergenic
1197327209 X:125108591-125108613 GCAACTCTTGTGCCTCAGCCAGG - Intergenic
1197494701 X:127163648-127163670 GCCACTCAGGTGGCTGAAGCAGG - Intergenic
1198452720 X:136783790-136783812 GGCTCTCTATTGCCTAAAGCAGG + Intergenic
1200899281 Y:8411811-8411833 TTCACTCTTGTCCCTCAAGCTGG + Intergenic
1202012577 Y:20360943-20360965 GCCACTCAAGTGGCTGAGGCAGG + Intergenic