ID: 973362873

View in Genome Browser
Species Human (GRCh38)
Location 4:49181324-49181346
Sequence GTGTGTCAGGGGCAGACGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973362873_973362877 -8 Left 973362873 4:49181324-49181346 CCTGTCGTCTGCCCCTGACACAC No data
Right 973362877 4:49181339-49181361 TGACACACTCAGCCACAGTGAGG No data
973362873_973362878 3 Left 973362873 4:49181324-49181346 CCTGTCGTCTGCCCCTGACACAC No data
Right 973362878 4:49181350-49181372 GCCACAGTGAGGACTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973362873 Original CRISPR GTGTGTCAGGGGCAGACGAC AGG (reversed) Intergenic
No off target data available for this crispr