ID: 973369658

View in Genome Browser
Species Human (GRCh38)
Location 4:49235152-49235174
Sequence CACCCAGGACAACCCCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973369658_973369667 9 Left 973369658 4:49235152-49235174 CCCTGATGGGGTTGTCCTGGGTG No data
Right 973369667 4:49235184-49235206 GTGATGAGAAAAATGCAGAATGG No data
973369658_973369668 22 Left 973369658 4:49235152-49235174 CCCTGATGGGGTTGTCCTGGGTG No data
Right 973369668 4:49235197-49235219 TGCAGAATGGAATTGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973369658 Original CRISPR CACCCAGGACAACCCCATCA GGG (reversed) Intergenic
No off target data available for this crispr