ID: 973374143

View in Genome Browser
Species Human (GRCh38)
Location 4:49276265-49276287
Sequence CAGTCCCTGCACTGGGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973374137_973374143 2 Left 973374137 4:49276240-49276262 CCCACAGACGAAAGTGTCTTCCC No data
Right 973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG No data
973374136_973374143 3 Left 973374136 4:49276239-49276261 CCCCACAGACGAAAGTGTCTTCC No data
Right 973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG No data
973374135_973374143 11 Left 973374135 4:49276231-49276253 CCTGGGAGCCCCACAGACGAAAG No data
Right 973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG No data
973374138_973374143 1 Left 973374138 4:49276241-49276263 CCACAGACGAAAGTGTCTTCCCA No data
Right 973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG No data
973374134_973374143 27 Left 973374134 4:49276215-49276237 CCACGGAGAAACACGGCCTGGGA No data
Right 973374143 4:49276265-49276287 CAGTCCCTGCACTGGGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973374143 Original CRISPR CAGTCCCTGCACTGGGACCC AGG Intergenic
No off target data available for this crispr