ID: 973374766

View in Genome Browser
Species Human (GRCh38)
Location 4:49279143-49279165
Sequence GTGTGCCAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973374765_973374766 -5 Left 973374765 4:49279125-49279147 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 973374766 4:49279143-49279165 GTGTGCCAGTAGCAAGTAGATGG No data
973374763_973374766 7 Left 973374763 4:49279113-49279135 CCATGACAGGGGCCTCTTCTGCT No data
Right 973374766 4:49279143-49279165 GTGTGCCAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973374766 Original CRISPR GTGTGCCAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr