ID: 973374766 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:49279143-49279165 |
Sequence | GTGTGCCAGTAGCAAGTAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
973374765_973374766 | -5 | Left | 973374765 | 4:49279125-49279147 | CCTCTTCTGCTGGCAAGAGTGTG | No data | ||
Right | 973374766 | 4:49279143-49279165 | GTGTGCCAGTAGCAAGTAGATGG | No data | ||||
973374763_973374766 | 7 | Left | 973374763 | 4:49279113-49279135 | CCATGACAGGGGCCTCTTCTGCT | No data | ||
Right | 973374766 | 4:49279143-49279165 | GTGTGCCAGTAGCAAGTAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
973374766 | Original CRISPR | GTGTGCCAGTAGCAAGTAGA TGG | Intergenic | ||
No off target data available for this crispr |