ID: 973375099

View in Genome Browser
Species Human (GRCh38)
Location 4:49280976-49280998
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973375089_973375099 6 Left 973375089 4:49280947-49280969 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG No data
973375082_973375099 23 Left 973375082 4:49280930-49280952 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG No data
973375090_973375099 5 Left 973375090 4:49280948-49280970 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG No data
973375081_973375099 29 Left 973375081 4:49280924-49280946 CCACATCCCTGGTGAGGAGCTGC No data
Right 973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG No data
973375083_973375099 22 Left 973375083 4:49280931-49280953 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG No data
973375087_973375099 7 Left 973375087 4:49280946-49280968 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973375099 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr