ID: 973375998

View in Genome Browser
Species Human (GRCh38)
Location 4:49286998-49287020
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973375982_973375998 29 Left 973375982 4:49286946-49286968 CCACATCCCTGGTGAGGAGCTGC No data
Right 973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG No data
973375984_973375998 22 Left 973375984 4:49286953-49286975 CCTGGTGAGGAGCTGCTCCTTGG No data
Right 973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG No data
973375983_973375998 23 Left 973375983 4:49286952-49286974 CCCTGGTGAGGAGCTGCTCCTTG No data
Right 973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG No data
973375989_973375998 5 Left 973375989 4:49286970-49286992 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973375998 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr