ID: 973376923

View in Genome Browser
Species Human (GRCh38)
Location 4:49293161-49293183
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973376911_973376923 7 Left 973376911 4:49293131-49293153 CCCCTTGGGTCTGAGTTTCTGGG No data
Right 973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG No data
973376913_973376923 6 Left 973376913 4:49293132-49293154 CCCTTGGGTCTGAGTTTCTGGGA No data
Right 973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG No data
973376907_973376923 22 Left 973376907 4:49293116-49293138 CCTGGTGAGGAGCTGCCCCTTGG No data
Right 973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG No data
973376914_973376923 5 Left 973376914 4:49293133-49293155 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG No data
973376905_973376923 29 Left 973376905 4:49293109-49293131 CCACATCCCTGGTGAGGAGCTGC No data
Right 973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG No data
973376906_973376923 23 Left 973376906 4:49293115-49293137 CCCTGGTGAGGAGCTGCCCCTTG No data
Right 973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973376923 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr