ID: 973377487

View in Genome Browser
Species Human (GRCh38)
Location 4:49297336-49297358
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973377486_973377487 -5 Left 973377486 4:49297318-49297340 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 973377487 4:49297336-49297358 GTGTGACAGTAGCAAGTAGATGG No data
973377484_973377487 7 Left 973377484 4:49297306-49297328 CCATGACGGGGGCCTCTTCTGCT No data
Right 973377487 4:49297336-49297358 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973377487 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr