ID: 973377487 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:49297336-49297358 |
Sequence | GTGTGACAGTAGCAAGTAGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
973377486_973377487 | -5 | Left | 973377486 | 4:49297318-49297340 | CCTCTTCTGCTGGCAAGAGTGTG | No data | ||
Right | 973377487 | 4:49297336-49297358 | GTGTGACAGTAGCAAGTAGATGG | No data | ||||
973377484_973377487 | 7 | Left | 973377484 | 4:49297306-49297328 | CCATGACGGGGGCCTCTTCTGCT | No data | ||
Right | 973377487 | 4:49297336-49297358 | GTGTGACAGTAGCAAGTAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
973377487 | Original CRISPR | GTGTGACAGTAGCAAGTAGA TGG | Intergenic | ||
No off target data available for this crispr |