ID: 973377843

View in Genome Browser
Species Human (GRCh38)
Location 4:49299316-49299338
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973377827_973377843 29 Left 973377827 4:49299264-49299286 CCACATCCCTGGTGAGGAGCTGC No data
Right 973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG No data
973377834_973377843 5 Left 973377834 4:49299288-49299310 CCTTGGGTCTGAGTTTCTGGGAG No data
Right 973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG No data
973377829_973377843 22 Left 973377829 4:49299271-49299293 CCTGGTGAGGAGCTGCTCCTTGG No data
Right 973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG No data
973377828_973377843 23 Left 973377828 4:49299270-49299292 CCCTGGTGAGGAGCTGCTCCTTG No data
Right 973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973377843 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr