ID: 973378405

View in Genome Browser
Species Human (GRCh38)
Location 4:49303472-49303494
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973378402_973378405 7 Left 973378402 4:49303442-49303464 CCATGACGGGGGCCTCTTCTGCT No data
Right 973378405 4:49303472-49303494 GTGTGACAGTAGCAAGTAGATGG No data
973378404_973378405 -5 Left 973378404 4:49303454-49303476 CCTCTTCTGCTGGCAAGAGTGTG No data
Right 973378405 4:49303472-49303494 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973378405 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr