ID: 973378787

View in Genome Browser
Species Human (GRCh38)
Location 4:49305596-49305618
Sequence AGGGAGAAGCTGGGTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973378772_973378787 23 Left 973378772 4:49305550-49305572 CCCTGGTGAGGAGTTGCCCCTTG No data
Right 973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG No data
973378776_973378787 7 Left 973378776 4:49305566-49305588 CCCCTTGGGTCTGAGTTTCTGAG No data
Right 973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG No data
973378771_973378787 29 Left 973378771 4:49305544-49305566 CCACATCCCTGGTGAGGAGTTGC No data
Right 973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG No data
973378777_973378787 6 Left 973378777 4:49305567-49305589 CCCTTGGGTCTGAGTTTCTGAGA No data
Right 973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG No data
973378778_973378787 5 Left 973378778 4:49305568-49305590 CCTTGGGTCTGAGTTTCTGAGAG No data
Right 973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG No data
973378773_973378787 22 Left 973378773 4:49305551-49305573 CCTGGTGAGGAGTTGCCCCTTGG No data
Right 973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973378787 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG Intergenic
No off target data available for this crispr