ID: 973379431

View in Genome Browser
Species Human (GRCh38)
Location 4:49310058-49310080
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973379431_973379441 6 Left 973379431 4:49310058-49310080 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973379441 4:49310087-49310109 TCTCAGAAACTCAGACCCAAGGG No data
973379431_973379445 22 Left 973379431 4:49310058-49310080 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973379445 4:49310103-49310125 CCAAGGGGCAACTCCTCACCAGG No data
973379431_973379440 5 Left 973379431 4:49310058-49310080 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973379440 4:49310086-49310108 CTCTCAGAAACTCAGACCCAAGG No data
973379431_973379447 29 Left 973379431 4:49310058-49310080 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973379447 4:49310110-49310132 GCAACTCCTCACCAGGGATGTGG No data
973379431_973379446 23 Left 973379431 4:49310058-49310080 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973379446 4:49310104-49310126 CAAGGGGCAACTCCTCACCAGGG No data
973379431_973379442 7 Left 973379431 4:49310058-49310080 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973379442 4:49310088-49310110 CTCAGAAACTCAGACCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973379431 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr