ID: 973380304

View in Genome Browser
Species Human (GRCh38)
Location 4:49316054-49316076
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973380304_973380316 7 Left 973380304 4:49316054-49316076 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973380316 4:49316084-49316106 CCCAGAAACTCAGACCCAAGGGG No data
973380304_973380320 22 Left 973380304 4:49316054-49316076 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973380320 4:49316099-49316121 CCAAGGGGCAGCTCCTCACCAGG No data
973380304_973380313 5 Left 973380304 4:49316054-49316076 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973380313 4:49316082-49316104 CTCCCAGAAACTCAGACCCAAGG No data
973380304_973380314 6 Left 973380304 4:49316054-49316076 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973380314 4:49316083-49316105 TCCCAGAAACTCAGACCCAAGGG No data
973380304_973380322 29 Left 973380304 4:49316054-49316076 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973380322 4:49316106-49316128 GCAGCTCCTCACCAGGGATATGG No data
973380304_973380321 23 Left 973380304 4:49316054-49316076 CCTGCCTCACCCAGCTTCTCCCT No data
Right 973380321 4:49316100-49316122 CAAGGGGCAGCTCCTCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973380304 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr