ID: 973380655

View in Genome Browser
Species Human (GRCh38)
Location 4:49318031-49318053
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973380655_973380656 -5 Left 973380655 4:49318031-49318053 CCATCTACTTGCTACTGTCACAC No data
Right 973380656 4:49318049-49318071 CACACTCTTGCCAGCAGAAGAGG No data
973380655_973380658 7 Left 973380655 4:49318031-49318053 CCATCTACTTGCTACTGTCACAC No data
Right 973380658 4:49318061-49318083 AGCAGAAGAGGCCCCCGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973380655 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr