ID: 973380655 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:49318031-49318053 |
| Sequence | GTGTGACAGTAGCAAGTAGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973380655_973380656 | -5 | Left | 973380655 | 4:49318031-49318053 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 973380656 | 4:49318049-49318071 | CACACTCTTGCCAGCAGAAGAGG | No data | ||||
| 973380655_973380658 | 7 | Left | 973380655 | 4:49318031-49318053 | CCATCTACTTGCTACTGTCACAC | No data | ||
| Right | 973380658 | 4:49318061-49318083 | AGCAGAAGAGGCCCCCGTCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973380655 | Original CRISPR | GTGTGACAGTAGCAAGTAGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||